ID: 1132359669

View in Genome Browser
Species Human (GRCh38)
Location 15:101201866-101201888
Sequence CTCCCAGTAGGTGTCCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132359660_1132359669 27 Left 1132359660 15:101201816-101201838 CCACCTTTCCTGAACTGTGTTCA 0: 1
1: 0
2: 3
3: 20
4: 254
Right 1132359669 15:101201866-101201888 CTCCCAGTAGGTGTCCAGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 173
1132359662_1132359669 19 Left 1132359662 15:101201824-101201846 CCTGAACTGTGTTCAAAGAGAAC 0: 1
1: 0
2: 1
3: 16
4: 167
Right 1132359669 15:101201866-101201888 CTCCCAGTAGGTGTCCAGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 173
1132359661_1132359669 24 Left 1132359661 15:101201819-101201841 CCTTTCCTGAACTGTGTTCAAAG 0: 1
1: 0
2: 3
3: 10
4: 194
Right 1132359669 15:101201866-101201888 CTCCCAGTAGGTGTCCAGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132359669 Original CRISPR CTCCCAGTAGGTGTCCAGGA GGG Intronic