ID: 1132361018

View in Genome Browser
Species Human (GRCh38)
Location 15:101215352-101215374
Sequence CCTACCCCTTCATCTTTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132361018_1132361020 26 Left 1132361018 15:101215352-101215374 CCATAAAAAGATGAAGGGGTAGG 0: 1
1: 0
2: 1
3: 12
4: 206
Right 1132361020 15:101215401-101215423 AGACCTTCACAGAGTTGCTATGG 0: 1
1: 0
2: 1
3: 10
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132361018 Original CRISPR CCTACCCCTTCATCTTTTTA TGG (reversed) Intronic
901415211 1:9111619-9111641 CCTACCCCTTCTTATTTTCCAGG - Intronic
902057693 1:13615906-13615928 CGTAACCCTTCAGCTCTTTAGGG - Exonic
902173885 1:14635019-14635041 CCTTCCCCCTCATCATTTTATGG - Intronic
903010100 1:20323683-20323705 CACACCACTTCATGTTTTTATGG - Intronic
904113500 1:28144990-28145012 TCAACCCCTTCATCTTACTAAGG - Intergenic
910005512 1:82391336-82391358 TCTACCCCATCCTCTTTTTTGGG - Intergenic
910942455 1:92551346-92551368 CCTCCCCCTTCTCCATTTTATGG + Intronic
911283605 1:95961521-95961543 CTTACCCATTCATCTGTTGATGG + Intergenic
911557538 1:99363177-99363199 CTTATCCATTCATCTGTTTAAGG + Intergenic
915041175 1:152969457-152969479 CCTACCCCTTCCTCTGGTGATGG + Intergenic
915582543 1:156823589-156823611 CAGACCCCTTCCTCTTTTGAGGG - Intronic
916347419 1:163809523-163809545 CCTTCCCCTTCATTTATGTAGGG + Intergenic
916626471 1:166563309-166563331 CCTTCCCCTTTGGCTTTTTAAGG - Intergenic
918681360 1:187358514-187358536 CCTTCCCCTTCATTTTTTGGAGG + Intergenic
919658558 1:200221294-200221316 GCAACCCCTTCAGCTTTTTGTGG - Intergenic
919675744 1:200380827-200380849 CCCACCTCTTCATCTTTCTGTGG - Intergenic
923959439 1:239060079-239060101 CTAACCCTATCATCTTTTTAAGG + Intergenic
924597729 1:245461950-245461972 CCTTCTCCTTCTTCTTTTTTTGG - Intronic
1064315522 10:14251799-14251821 CCTGTCCCTTCATTTTTTGATGG + Intronic
1066195246 10:33092917-33092939 TCTATCCCCTCAACTTTTTAAGG - Intergenic
1067903409 10:50265401-50265423 TCTTCCTCTTCATCTTTTTTGGG - Intergenic
1068548387 10:58378767-58378789 TCTACCTCTTCATTTTTTGATGG + Intergenic
1068775207 10:60861516-60861538 TCTACCTCTTAATCTTTTCATGG + Intergenic
1070093328 10:73311301-73311323 CCTCTCCCTCCATCTTCTTATGG + Intronic
1071856997 10:89635997-89636019 CCTACCCCTACAGCTTTGTTTGG + Intronic
1072150805 10:92681343-92681365 CATACCCCTTCATCATCTGAGGG + Intergenic
1074717265 10:116231159-116231181 CCAATCCCTGCATCTTTTTCAGG - Intronic
1074767335 10:116709144-116709166 CCTATCCCTTCATCTGTTGTTGG - Intronic
1074855971 10:117473798-117473820 ACAACCCCTGCTTCTTTTTAAGG + Intergenic
1075368889 10:121918035-121918057 CCAGCCACATCATCTTTTTATGG - Intronic
1077753954 11:5005409-5005431 CCTCCCCCTTCCCCCTTTTAAGG + Intergenic
1078596446 11:12691045-12691067 CCAACCCATTCCTCTTTTTATGG + Intronic
1080591837 11:33731202-33731224 CCTAACCCTGCATTGTTTTAGGG + Intronic
1081897661 11:46600533-46600555 CCTTCCCCTCCATCATTTTGGGG + Intergenic
1085583205 11:77674510-77674532 CCTAAACCTTCATCTTCATAGGG - Intronic
1086219217 11:84421108-84421130 CCTTCCCCTTCAACCTTGTAAGG + Intronic
1087566595 11:99867652-99867674 CCTCCCCCTTCTACTTTTGAGGG + Intronic
1088117383 11:106327780-106327802 CCTTCCTTTTAATCTTTTTATGG + Intergenic
1088706053 11:112465690-112465712 CCCACCCCTACATTTTTTCAAGG - Intergenic
1089626910 11:119756807-119756829 CTTACCCATTCATCTGTTGATGG - Intergenic
1089940536 11:122411780-122411802 CCTTCCCCTTCACCCTTTGAAGG - Intergenic
1090748672 11:129727380-129727402 CCTACTCCCTCAGCTTTCTAGGG - Intergenic
1092714660 12:11376675-11376697 CCCATCATTTCATCTTTTTATGG + Intronic
1092718369 12:11415690-11415712 CCCATCATTTCATCTTTTTATGG + Intronic
1093296038 12:17392745-17392767 CTTACCTTGTCATCTTTTTAAGG + Intergenic
1094691465 12:32773644-32773666 GCTTCCCCTTCATCTCTTTGAGG - Intergenic
1098396464 12:70023527-70023549 TCTATCCATTCATCTTTTGATGG - Intergenic
1098510859 12:71312545-71312567 GCTTCCACTGCATCTTTTTACGG + Intronic
1098986093 12:77014042-77014064 CCCACCCCTTCATTGTTTAAGGG + Intergenic
1101091388 12:101290191-101290213 CCAACACCTTCAACTTTTTCTGG - Exonic
1103124768 12:118411799-118411821 CCAACTCCTGCTTCTTTTTAAGG + Intronic
1105863935 13:24442198-24442220 CCTTCCCCTTCATAAGTTTAAGG - Intronic
1106084525 13:26528785-26528807 CCTATCCCTTCCTCTTTGTGTGG - Intergenic
1108009808 13:45994362-45994384 CCTACCCCTTCATTGTTCAAGGG + Intronic
1110128254 13:71975460-71975482 CTTATCCATTCATCTTTTGATGG + Intergenic
1111524402 13:89449918-89449940 CATACACCTTCAGCTTATTATGG + Intergenic
1112943815 13:104899473-104899495 CCTATCCATTCATCTATTGATGG - Intergenic
1115350159 14:32385298-32385320 TCTTCCCCTTTATCTTTTGATGG + Intronic
1117309207 14:54505318-54505340 TCTGCTCCTTCAGCTTTTTATGG - Intergenic
1119869416 14:78002553-78002575 TCTACCCCTGCTTTTTTTTAAGG + Intergenic
1120026502 14:79590921-79590943 CCATCCCCTCCATCTTTCTAAGG + Intronic
1120769846 14:88367021-88367043 CCTATCCATTCATCTTTTGATGG + Intergenic
1122264655 14:100540962-100540984 CCCACCCCGTCATCTTTGGAAGG - Intronic
1122606717 14:102951491-102951513 CCCAGCCCATCATATTTTTAAGG - Intronic
1123982977 15:25620787-25620809 CTTACCCATTCATCTGTTGATGG - Intergenic
1124804857 15:32871319-32871341 CTTGCCCCTCCATCATTTTATGG + Intronic
1125347222 15:38730509-38730531 CCTAACCTTTTATCTCTTTAAGG + Intergenic
1125794177 15:42392312-42392334 TCTACCCCTTCCTCCTTTGAAGG + Intronic
1127367802 15:58308066-58308088 CCTCCCCCTGTTTCTTTTTATGG + Intronic
1127482528 15:59390673-59390695 CCAACCACCTCATCTTTTTCAGG + Intronic
1128665218 15:69532583-69532605 CCTACACCTTCCTCTGTTCAAGG - Intergenic
1129029731 15:72609500-72609522 CCTACCCCTTGCCCTTTTAAGGG - Intergenic
1131415188 15:92249625-92249647 CTTACCCATTCATCTGTTGATGG + Intergenic
1132361018 15:101215352-101215374 CCTACCCCTTCATCTTTTTATGG - Intronic
1133467387 16:6040943-6040965 CATATCCATTCATCTTTTGATGG + Intronic
1134069660 16:11253174-11253196 CCTCCCACTTCACCTTATTAAGG + Intronic
1136028189 16:27483576-27483598 CCTTCCCCTTCATTTTCTTTTGG - Intronic
1136591487 16:31220404-31220426 CCTACCCCTTCACTTTTATGTGG - Intronic
1147212444 17:38879738-38879760 ACCACTCTTTCATCTTTTTAGGG + Intronic
1148539113 17:48465741-48465763 CCTTCTCCTTCTTCTTTTTGAGG - Intergenic
1149156826 17:53641135-53641157 CTTATCCTTTCATCTGTTTATGG + Intergenic
1149982320 17:61321179-61321201 CTTACCTCTTCATTTGTTTAAGG + Intronic
1150205148 17:63398845-63398867 ACTTCCTCTTCATCTTTTTCTGG - Exonic
1153352432 18:4095868-4095890 CCTACCCCTCCTTCTTTCTAAGG - Intronic
1157195603 18:45617938-45617960 CCTAAGCCTTCATTTTTCTAGGG - Intronic
1162017433 19:7853166-7853188 CCGACCTCTTCATCTTCTTGGGG - Exonic
1163252669 19:16135534-16135556 CCTACTCCTTCCTCTTTCTCTGG + Intronic
1166177540 19:41085633-41085655 CTTACCTCTTCAGCTATTTAGGG - Intergenic
925714104 2:6769017-6769039 CCTCCACGTACATCTTTTTATGG - Intergenic
926551369 2:14305580-14305602 CCTTCGCCTTCATCTTCATATGG - Intergenic
927332463 2:21881839-21881861 CCTACTTCTTCATCTTTATGGGG - Intergenic
928055626 2:28051326-28051348 CCTACTCTTTCATCTTTTTCTGG + Intronic
930314215 2:49777632-49777654 CATACCCATTCATCTGTTGATGG - Intergenic
930321633 2:49862093-49862115 CTTTCCCCTTCACCTTATTAAGG + Intergenic
930328851 2:49956918-49956940 CCTACCCATTCATGATTATATGG - Intronic
931253582 2:60552764-60552786 CCTACCCCCCCATTTTCTTACGG + Intronic
931391322 2:61846397-61846419 CCAACCCTTTCATCTTTGAAGGG - Intronic
932989492 2:76769130-76769152 CCTTCACCTGCCTCTTTTTATGG - Intronic
935934129 2:108163383-108163405 CCTATCCCTTCTTCTATTTCAGG - Intergenic
936853028 2:116924503-116924525 CCAACCCCAGGATCTTTTTAAGG + Intergenic
936863825 2:117055181-117055203 TCTACCCCTTGATCATTTTCAGG + Intergenic
939145693 2:138412124-138412146 CCTACCTCATCATGTTTTAATGG - Intergenic
940386556 2:153080227-153080249 CTTACCCCTTTTTCTTTTTGGGG + Intergenic
943173999 2:184444940-184444962 ATTACCTCTTCATCTTTTTTGGG - Intergenic
943236720 2:185331115-185331137 CCTTCCTCTTCAATTTTTTAGGG + Intergenic
944380781 2:199108026-199108048 CCTACCCATTCTTCATTTGATGG + Intergenic
944553931 2:200869537-200869559 CCTGCCCCTTCCTCCTTTTTTGG - Intergenic
1169490919 20:6070815-6070837 CCTACCTTTTCCTTTTTTTAAGG + Intergenic
1172757686 20:37298636-37298658 CTTATCCATTCATCTGTTTATGG + Intronic
1177010363 21:15724845-15724867 CCTTCCCCTTCATCTTTTGAAGG - Intergenic
1177746511 21:25221746-25221768 CCCACACCTTCATCATTTTAGGG + Intergenic
1177888467 21:26775816-26775838 TCAGCTCCTTCATCTTTTTATGG + Intergenic
1179064413 21:38010866-38010888 CCTACCCTTTCATCCTATAATGG - Intronic
1182365836 22:29778314-29778336 CCTACCTCTGCATCTTTCTCCGG + Intergenic
1182396194 22:30037961-30037983 CCTTCCCCTTCATTTGTTAATGG + Intergenic
1182969315 22:34557596-34557618 TCTCCACCTTCATCTTTTCATGG + Intergenic
949707886 3:6839924-6839946 TCTACCTCCTAATCTTTTTAAGG + Intronic
951758215 3:26116386-26116408 CTTATCCCTTCATCTGTTGATGG + Intergenic
952270891 3:31830320-31830342 CTTTCCCCTTCCTCTCTTTAGGG + Intronic
953634424 3:44650780-44650802 CCAACCCCTTCATCCTATGAGGG + Intronic
954814291 3:53268451-53268473 CCTACCCATTCATCAGTTCACGG + Intergenic
959328972 3:104977661-104977683 ACTACCCCTTCATGACTTTAAGG + Intergenic
959405859 3:105961159-105961181 GTTATCCCTTCATCTGTTTATGG + Intergenic
959981358 3:112521491-112521513 CTTATCCATTCATCTTTTGATGG + Intergenic
960009126 3:112813945-112813967 CCTCCCCCATCATCTTTTAGAGG - Intronic
962423604 3:135249632-135249654 CATCCCCCTTCATCTTTCCAAGG - Intronic
963370835 3:144397653-144397675 CCTATCCATTAATCTTTTGATGG + Intergenic
963480158 3:145862493-145862515 TATACCCCTTCATCTGTTGATGG + Intergenic
964954884 3:162341404-162341426 CCAATTCCTTCATTTTTTTATGG - Intergenic
965789790 3:172375093-172375115 CCTACCCTTTCCTCTTCTTAAGG - Intronic
966876959 3:184327867-184327889 CCTTGCTCTTCATCTTTGTACGG + Exonic
967194893 3:187017563-187017585 CCTTCCCCTTTTTCTTTGTAGGG + Intronic
971334588 4:25710871-25710893 ACTACCCCTTCATCTGCATAGGG + Intergenic
972722851 4:41718056-41718078 CCTGCCCCTATATCTTTTTGTGG + Intergenic
972772731 4:42213008-42213030 ACTACTACTTCATCTTTCTAGGG - Intergenic
973740864 4:53918197-53918219 TTTACCCATTCATCTTTTGATGG - Intronic
977226714 4:94400778-94400800 CATAACCATTCATCTTCTTATGG + Intergenic
978847547 4:113292112-113292134 CCACCCCCTTCACCTTCTTAAGG + Intronic
983635819 4:169896850-169896872 CATACTCCTCCATCTTCTTAAGG + Intergenic
984074406 4:175157086-175157108 CCTATCCTTTCAGATTTTTACGG + Intergenic
984168876 4:176337181-176337203 CTTACCCCTTCACTTTTTCATGG + Intergenic
984535674 4:180972128-180972150 GCTACCCCTTAATTCTTTTATGG - Intergenic
986889583 5:12285330-12285352 CTTTCACTTTCATCTTTTTACGG - Intergenic
989591205 5:43114600-43114622 CCTGCTCCTTGATCTTTTTGTGG - Intronic
992426413 5:76662402-76662424 CCTACCCTCTCATCTGTATATGG + Intronic
994028155 5:95108829-95108851 CCCAGACCTTCATCCTTTTAAGG - Intronic
994440619 5:99798933-99798955 CATAACCCTGCATCTTTCTACGG + Intergenic
995293744 5:110492910-110492932 CCAACCCCTACATCATTTTGAGG - Intronic
996059765 5:119020513-119020535 AATATACCTTCATCTTTTTAAGG - Intergenic
996121128 5:119673240-119673262 CCCATCCATTCATCTTTTAATGG + Intergenic
996228832 5:121035273-121035295 CCTGGCACTTCATTTTTTTATGG - Intergenic
997105430 5:131013490-131013512 CCTATCCATTCATCTGTTTATGG - Intergenic
998963911 5:147517155-147517177 CCTATCCCTTCATCTTAATTAGG - Intergenic
1004169852 6:13287463-13287485 CCCACCCCTTCAGCTTTCTTTGG - Exonic
1004563345 6:16772020-16772042 CCCACTCCTTCATCTTCTTCAGG + Intergenic
1005084806 6:21994036-21994058 CCTGCCCATTCATCTTCTCATGG - Intergenic
1005132021 6:22520443-22520465 CCTTCCCTTTCATCTTTTTCTGG - Intergenic
1009968092 6:70598498-70598520 TCTCCCCCTTCTTCTCTTTATGG + Intergenic
1010683446 6:78823165-78823187 CCTCCATCTTCATCTCTTTAGGG - Intergenic
1013981291 6:116132764-116132786 TCTAATCCTTCATCCTTTTAGGG + Intronic
1014775936 6:125510042-125510064 TATACCACTTCATCTTTTTGGGG - Intergenic
1015450516 6:133362088-133362110 CCCACACCTTCATCTTCTAAGGG - Intronic
1015811049 6:137162498-137162520 CTTCCCCATTCATCTTTTTAAGG - Intronic
1018256995 6:161930788-161930810 CCTTCCCCTTCTACCTTTTAAGG - Intronic
1019068649 6:169323555-169323577 CTTACCCCTTCATCATGTAATGG + Intergenic
1020897835 7:13964271-13964293 ACTACCCATACATCTTTATAGGG + Intronic
1021769016 7:23979994-23980016 CATGCATCTTCATCTTTTTAGGG + Intergenic
1023522555 7:41062579-41062601 CCCACCCCTTCATGTAGTTAAGG + Intergenic
1023559696 7:41460826-41460848 CCTACCCATTCATCTGTCAATGG - Intergenic
1024671636 7:51600879-51600901 CCTACTCCATCATATGTTTAGGG + Intergenic
1024910545 7:54443489-54443511 CCTCCCCCTCCCTCTTTCTACGG + Intergenic
1028008744 7:85613667-85613689 CCTATCCATTCATCTGTTGATGG - Intergenic
1030443342 7:109616773-109616795 TCTACCCATTCATCTGTTGATGG + Intergenic
1030643498 7:112032747-112032769 CCTATCCCTCCACCTTTTTAAGG - Intronic
1030877720 7:114836034-114836056 CATACCCATTCATCTGTTGATGG + Intergenic
1031211761 7:118838046-118838068 ACTTCCCCTTCATCCTTTGAAGG + Intergenic
1031278532 7:119764609-119764631 CCTACCCTTTCACCTCATTAGGG - Intergenic
1031557471 7:123195506-123195528 CCTACCACTTCCTCCTTCTAGGG + Intronic
1032698075 7:134355047-134355069 AGTACCCCTCCTTCTTTTTACGG - Intergenic
1033927195 7:146477976-146477998 CCTACCACTTAATCTTTCTGAGG - Intronic
1033994972 7:147334221-147334243 CCTTCCTCTTCAACTTTTAATGG + Intronic
1034484571 7:151350855-151350877 TCTATCCCTTCATCTGTTGATGG - Intronic
1035971860 8:4258239-4258261 CCTACCCCTTCCTATCTTAAAGG + Intronic
1036196182 8:6717022-6717044 CTTCCTCCTTCATCTATTTAAGG - Intronic
1037389284 8:18376287-18376309 CTTACCCATTCATCTGTTGATGG - Intergenic
1039761207 8:40577281-40577303 CCTATCCATTCATCTATTGATGG - Intronic
1041163234 8:55066108-55066130 CCTACTCCTTCACCTCTTCATGG + Intergenic
1041641383 8:60206664-60206686 CCTGCCCCTTCATCATTAAATGG + Intronic
1041905584 8:63029972-63029994 CCTGCCTCTTCCTCTTTTGAAGG + Intronic
1042401917 8:68359641-68359663 CCCACCCCTCTCTCTTTTTAAGG + Intronic
1044731800 8:95234589-95234611 TCTAACCCTTCTTCTGTTTATGG - Intergenic
1045228716 8:100278896-100278918 CAAACCCCTTCATGTTTTTATGG - Intronic
1045436949 8:102173350-102173372 TCTGCCCCTTCAGCTTTGTAGGG + Intergenic
1045545731 8:103126599-103126621 CCGTCCCCTTCATCTTCTCAAGG + Intergenic
1045569617 8:103355407-103355429 TCTACCCCTTCATGGTTTCATGG - Intergenic
1045745317 8:105412211-105412233 CCTTCCCCTTCATTTTTCAATGG + Intronic
1050417440 9:5432502-5432524 CCTCCCCCTCCCTCTTTCTACGG + Intronic
1051450096 9:17187370-17187392 CCTGCGCTTTCATGTTTTTAAGG + Intronic
1051609603 9:18948396-18948418 CCTGCCACTTTTTCTTTTTAAGG + Intronic
1051726997 9:20098306-20098328 CCTCCCCACTCATCTTATTATGG - Intergenic
1052143220 9:25014868-25014890 CCTACGCATCCATTTTTTTATGG - Intergenic
1052539307 9:29787478-29787500 TTTATCCATTCATCTTTTTATGG - Intergenic
1052954721 9:34244761-34244783 CCTATCCATTCATCTCTTGATGG + Intronic
1052958563 9:34274417-34274439 CCTATCCATTCATCTCTTGATGG - Intronic
1054935628 9:70684416-70684438 CCTCCCTTTTCCTCTTTTTAAGG - Intronic
1056556239 9:87691061-87691083 CCTGCCCCTTCAGTTTTTTTTGG + Intronic
1057191563 9:93091001-93091023 CCTATCCATTCATCTCTTGATGG + Intergenic
1057773800 9:97988940-97988962 CATACCCTTTCCTCCTTTTATGG + Intronic
1059547981 9:115198129-115198151 TCTAGCCCTTCCTCTTTTTCTGG + Intronic
1059721901 9:116968195-116968217 CCTACTCCTTCTTCTCTTTCTGG + Intronic
1060687959 9:125629356-125629378 TTTATCCATTCATCTTTTTATGG - Intronic
1186773770 X:12843699-12843721 CATATGCCTTCATCTTGTTATGG - Intergenic
1188425539 X:30042998-30043020 CTTACTCCTTCTTCCTTTTAGGG - Intergenic
1189173642 X:38932857-38932879 CCTTATCCTTCATCTCTTTATGG + Intergenic
1189249239 X:39587270-39587292 TCTCCACCTTCATCTTTTCATGG + Intergenic
1190806957 X:53847002-53847024 TCTATCCCTTCATCTGTTGATGG + Intergenic
1191784772 X:64905554-64905576 CCAATCCCTCCATCTTTTTGTGG - Intergenic
1196036768 X:111153900-111153922 TTTACCCCTTCATCTGTTGATGG - Intronic
1197250466 X:124210469-124210491 ACTACTGCTTCATCTTTTAAAGG - Intronic
1197631695 X:128868563-128868585 CCTGTCCCTGCATCTGTTTAAGG - Intergenic