ID: 1132365126

View in Genome Browser
Species Human (GRCh38)
Location 15:101251565-101251587
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 680
Summary {0: 2, 1: 0, 2: 13, 3: 69, 4: 596}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132365118_1132365126 0 Left 1132365118 15:101251542-101251564 CCTAGCGCCGCGAGGCCCGGCCC 0: 1
1: 0
2: 2
3: 25
4: 297
Right 1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG 0: 2
1: 0
2: 13
3: 69
4: 596
1132365121_1132365126 -7 Left 1132365121 15:101251549-101251571 CCGCGAGGCCCGGCCCGGGCAGC 0: 1
1: 0
2: 3
3: 39
4: 388
Right 1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG 0: 2
1: 0
2: 13
3: 69
4: 596
1132365114_1132365126 5 Left 1132365114 15:101251537-101251559 CCCGCCCTAGCGCCGCGAGGCCC 0: 1
1: 0
2: 0
3: 15
4: 132
Right 1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG 0: 2
1: 0
2: 13
3: 69
4: 596
1132365110_1132365126 19 Left 1132365110 15:101251523-101251545 CCCGCGGAGGCCAGCCCGCCCTA 0: 1
1: 0
2: 1
3: 7
4: 108
Right 1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG 0: 2
1: 0
2: 13
3: 69
4: 596
1132365117_1132365126 1 Left 1132365117 15:101251541-101251563 CCCTAGCGCCGCGAGGCCCGGCC 0: 1
1: 0
2: 0
3: 9
4: 84
Right 1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG 0: 2
1: 0
2: 13
3: 69
4: 596
1132365112_1132365126 9 Left 1132365112 15:101251533-101251555 CCAGCCCGCCCTAGCGCCGCGAG 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG 0: 2
1: 0
2: 13
3: 69
4: 596
1132365106_1132365126 25 Left 1132365106 15:101251517-101251539 CCCCCGCCCGCGGAGGCCAGCCC 0: 1
1: 0
2: 2
3: 33
4: 277
Right 1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG 0: 2
1: 0
2: 13
3: 69
4: 596
1132365115_1132365126 4 Left 1132365115 15:101251538-101251560 CCGCCCTAGCGCCGCGAGGCCCG 0: 1
1: 0
2: 0
3: 3
4: 96
Right 1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG 0: 2
1: 0
2: 13
3: 69
4: 596
1132365111_1132365126 18 Left 1132365111 15:101251524-101251546 CCGCGGAGGCCAGCCCGCCCTAG 0: 1
1: 0
2: 1
3: 15
4: 128
Right 1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG 0: 2
1: 0
2: 13
3: 69
4: 596
1132365108_1132365126 23 Left 1132365108 15:101251519-101251541 CCCGCCCGCGGAGGCCAGCCCGC 0: 1
1: 0
2: 0
3: 26
4: 195
Right 1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG 0: 2
1: 0
2: 13
3: 69
4: 596
1132365109_1132365126 22 Left 1132365109 15:101251520-101251542 CCGCCCGCGGAGGCCAGCCCGCC 0: 1
1: 0
2: 1
3: 24
4: 195
Right 1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG 0: 2
1: 0
2: 13
3: 69
4: 596
1132365107_1132365126 24 Left 1132365107 15:101251518-101251540 CCCCGCCCGCGGAGGCCAGCCCG 0: 1
1: 0
2: 0
3: 21
4: 193
Right 1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG 0: 2
1: 0
2: 13
3: 69
4: 596

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900180130 1:1307657-1307679 GGGCCGGGCCGCGGCCGCCGGGG - Intronic
900349814 1:2228939-2228961 GGGCACCGGCGCCGGCACCGCGG - Exonic
900483702 1:2911398-2911420 CAGCAGCGCCGCGGCGGCCGCGG - Intergenic
900511747 1:3064101-3064123 GGGGAGCTCCCCCGCCGCTGGGG - Intergenic
901002284 1:6154777-6154799 GGGCAGCTCCGCGGCAGCAGCGG - Exonic
901637821 1:10678479-10678501 GGGCAGCACCGCCCCCGCGAGGG + Intronic
901796165 1:11680878-11680900 GGGCAGGGCCGCGGACGCAGAGG + Intronic
901805497 1:11736171-11736193 GGGCACCTGCGCCGCAGCCGCGG - Exonic
902286200 1:15410066-15410088 GGGCAGCGGCGGCGGCGGCGGGG + Exonic
902335507 1:15752142-15752164 GGTCAGCGCCGCTGCAGCAGAGG + Intergenic
902400831 1:16155855-16155877 GCCCTGCGCCGCCGCGGCCGCGG + Exonic
902856522 1:19210198-19210220 CGGCAGCGGCTCCGGCGCCGGGG - Exonic
903514737 1:23902841-23902863 CAGCAACGCCGGCGCCGCCGTGG - Intronic
903950673 1:26994300-26994322 GGCCCGCGCCGCGGCCGCCGCGG + Exonic
904037922 1:27568695-27568717 GGGCACCCGCGCCGCGGCCGGGG - Intronic
904181369 1:28668904-28668926 GGGCCGCGCGGCGGCCGGCGAGG + Intronic
904181398 1:28668988-28669010 GCGTGCCGCCGCCGCCGCCGGGG + Intronic
904252931 1:29237667-29237689 GGGCCCCGCGGCCGCCGCCTCGG + Intronic
904641988 1:31938059-31938081 CGCCGCCGCCGCCGCCGCCGAGG - Exonic
904782932 1:32964389-32964411 AGGCTCCGCCGCCGCCGCCGCGG + Exonic
905449285 1:38046642-38046664 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
905867112 1:41382390-41382412 GGGCCACGCCGCCGCCTTCGGGG + Exonic
906204395 1:43979335-43979357 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
906534519 1:46544177-46544199 GCCCATCGCTGCCGCCGCCGGGG - Intergenic
906615621 1:47231201-47231223 GGGCAGAGCAGCCGCCGACCGGG + Intronic
906615824 1:47232213-47232235 GGGCCGGGCCGCCGCCGCTCAGG - Intronic
906637015 1:47416490-47416512 GGCCGCCGCCGCCGCCGCCCCGG - Exonic
906640828 1:47439392-47439414 GTGCTGCCCCGCCGCCACCGTGG - Exonic
906960920 1:50419099-50419121 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
908355846 1:63324102-63324124 GGGCGCCGCCGCGGCCGCTGCGG + Exonic
908714299 1:67053782-67053804 GGCCTGGGCCGCCGCCGCCTCGG + Intronic
909075624 1:71047669-71047691 GGGCAGCCCAGCCCCAGCCGCGG - Exonic
910759106 1:90718023-90718045 GGCCCGCGCCCCCGCCACCGAGG + Intergenic
912246276 1:107964919-107964941 GGCCGCCGCCGCCGCCGCCGCGG + Exonic
914044260 1:144077800-144077822 TTGCATCCCCGCCGCCGCCGTGG + Intergenic
915225031 1:154405670-154405692 GGCCAGCGCCGCTCCCGGCGCGG - Exonic
915246348 1:154558628-154558650 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
916065505 1:161132641-161132663 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
916738726 1:167630237-167630259 GCGCAGGGCCCCCGCGGCCGGGG + Exonic
917345182 1:174022158-174022180 GGCAGCCGCCGCCGCCGCCGAGG + Exonic
918015957 1:180632460-180632482 CCGCAGCCCCGCTGCCGCCGGGG + Intronic
919070689 1:192751496-192751518 GGGCAGCTCCGCCGCAGCCCTGG + Intergenic
920260538 1:204685270-204685292 GGGCAGCGCCGCCGCCGCCGGGG - Intronic
920352168 1:205344302-205344324 GAGAAGCGGAGCCGCCGCCGGGG + Exonic
922200076 1:223393860-223393882 GGGCAGGGCTGCGGCCGCTGGGG - Exonic
922798813 1:228354576-228354598 GGGCAGCGCCCACCCCGCAGAGG - Intronic
923119705 1:230978770-230978792 GGGCGGCGCTGTGGCCGCCGCGG - Exonic
924754786 1:246931492-246931514 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1062759937 10:10733-10755 GCGCAGCGCCGGCGCAGGCGCGG + Intergenic
1062759944 10:10762-10784 GCGCAGCGCCGGCGCAGGCGCGG + Intergenic
1063450064 10:6145123-6145145 GGGCGGCACCGCCGCAGCCCGGG - Intronic
1064022877 10:11823626-11823648 GCCCGGCGCCGCCGCCGCAGAGG + Intronic
1064443172 10:15371242-15371264 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1064712435 10:18140768-18140790 CGCCACCGCCGCCGCCGCTGTGG - Exonic
1064859773 10:19815553-19815575 GGTCCCCGCCGCTGCCGCCGCGG - Intergenic
1070333099 10:75431764-75431786 GGCCAGCCCCGCCTCCGCCCGGG + Intronic
1070570643 10:77637740-77637762 TGCCGCCGCCGCCGCCGCCGCGG + Intronic
1070800782 10:79243345-79243367 GGCCGCCGCCGCCGCCGCCGAGG - Intronic
1070800837 10:79243560-79243582 CCGCGCCGCCGCCGCCGCCGGGG + Intronic
1071526654 10:86363325-86363347 GGGCGGAGGCGCCGCCGCCTGGG - Intronic
1071997519 10:91162877-91162899 CAGCGCCGCCGCCGCCGCCGCGG + Intergenic
1071997722 10:91163507-91163529 CAGCAGCGGCGCCTCCGCCGAGG + Intronic
1072336657 10:94403482-94403504 GGGCACCGGCGGCCCCGCCGGGG - Exonic
1072421106 10:95291067-95291089 GGGCGGAGCCGCCCCCGCCCTGG - Intergenic
1072719501 10:97771932-97771954 AGCCGCCGCCGCCGCCGCCGCGG + Exonic
1072891606 10:99329723-99329745 GGGCCACGCCGCCACCGCCCGGG - Exonic
1074865456 10:117542237-117542259 GGCCGGCGCCGCCTCCGCTGCGG - Intergenic
1076638912 10:131901018-131901040 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
1076650236 10:131982225-131982247 GGGCTGCGCGGTCGCCGCCGCGG + Intergenic
1076792811 10:132785949-132785971 GGGCGCCGCCGCCGCCGGCCCGG + Exonic
1076895407 10:133308987-133309009 AGGCAGCGGCTCCGCCGCCCCGG - Exonic
1076949748 10:133670938-133670960 GTGCAGCGCGGCCCCCGGCGGGG + Intronic
1076950732 10:133674237-133674259 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
1076951722 10:133677547-133677569 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
1076952711 10:133680857-133680879 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
1076953695 10:133684156-133684178 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
1076955668 10:133743818-133743840 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
1076956658 10:133747128-133747150 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
1076957645 10:133750437-133750459 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
1076959619 10:133757046-133757068 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
1076960603 10:133760345-133760367 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
1077092830 11:787478-787500 GGGGAGCCCCGACGCCGGCGGGG - Exonic
1077214546 11:1389998-1390020 CGCCGCCGCCGCCGCCGCCGAGG - Intronic
1078659824 11:13277857-13277879 ACTCACCGCCGCCGCCGCCGCGG + Exonic
1078801059 11:14644271-14644293 GAGCAGCGCCGCGGCTGCTGGGG - Exonic
1079689405 11:23403534-23403556 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1080802100 11:35618651-35618673 GCGGGGCGCCGCCGCCACCGCGG + Exonic
1080836297 11:35944038-35944060 GGTCAGCGCCGAGGCCGCGGGGG + Intronic
1081488360 11:43548250-43548272 GGACAGGGACGCGGCCGCCGAGG - Intergenic
1081812804 11:45922869-45922891 GGGCAGCATGGCCGCCGACGGGG - Exonic
1081845597 11:46238350-46238372 GCGCCGCGCCGCCTCCGCCCGGG - Intergenic
1081872421 11:46389531-46389553 GGAGCGAGCCGCCGCCGCCGGGG + Intergenic
1082807725 11:57461028-57461050 GGGCCGCGCCCCCGCCGCCAGGG + Intronic
1082928992 11:58579510-58579532 GGGCTGCTCCTCCGCCGGCGGGG - Exonic
1082986080 11:59172361-59172383 GCGCGCCGCCGCCGCCGCCGGGG - Intronic
1083772982 11:64878672-64878694 GGCTAGCGCCGCCGCGGCGGGGG + Exonic
1083904829 11:65662776-65662798 TGGCATCGCCGGGGCCGCCGCGG - Intronic
1083970302 11:66070403-66070425 CGCCCCCGCCGCCGCCGCCGCGG + Intronic
1084000152 11:66291782-66291804 CGGCGGCGCCGCCGGTGCCGCGG + Intergenic
1084000197 11:66291929-66291951 GGGCTGCGACGCGGCCCCCGGGG - Exonic
1084265616 11:68003872-68003894 GGCCCGCCCCGCCCCCGCCGGGG + Intronic
1084395032 11:68903936-68903958 GGCCATCGCCGCCGCCGGCCTGG - Exonic
1085044040 11:73343205-73343227 GGGCCCAGCCGCCGCCTCCGGGG + Intronic
1085295662 11:75430318-75430340 GGCCAGCGCCGCCGCCGCCCCGG + Exonic
1085312699 11:75525691-75525713 GGGCAGGGCAGGCGCCGGCGGGG + Exonic
1086397457 11:86431580-86431602 GGGCAGTGCTGCGGCCGCCGCGG + Intergenic
1086887838 11:92224978-92225000 CGCCGCCGCCGCCGCCGCCGGGG - Intergenic
1089694915 11:120211062-120211084 GGGCAGCGCCGTCTCCGCCTCGG + Exonic
1089993417 11:122882874-122882896 GGGCAGCGCCGGGGCGGGCGGGG + Exonic
1090204342 11:124876366-124876388 GGGCAGCGGCGCAGCCTGCGGGG + Exonic
1090293885 11:125569540-125569562 GGGCAGGGCCGGAGCCGCGGCGG + Exonic
1090699312 11:129279630-129279652 GAGGCGCGCCGCCGCGGCCGCGG + Intergenic
1091335338 11:134762206-134762228 CAGCAGCGCAGACGCCGCCGGGG + Intergenic
1091616064 12:2052511-2052533 GGGACGCGCCGCCGCAGCGGAGG + Intronic
1091616085 12:2052569-2052591 GGGGCGCGACGCCGCCGGCGGGG + Intronic
1091823164 12:3491292-3491314 GACCGCCGCCGCCGCCGCCGCGG + Exonic
1093464976 12:19439851-19439873 CAGCAGCGCCGCCACCGCCTCGG - Exonic
1094199227 12:27780129-27780151 GGGCAGGGCCGCCGCCTCGCGGG + Exonic
1094564892 12:31590677-31590699 GCTCAGCGCCGCCGCAGCCCTGG + Intronic
1094564937 12:31590853-31590875 GGCCGCCGCCGCCGCCGCCCGGG + Exonic
1095271475 12:40224691-40224713 CGGCCGCGCCGCCGCTGCGGTGG + Intronic
1095476252 12:42589825-42589847 GCGGAGCGCGGACGCCGCCGCGG + Intronic
1096148709 12:49295757-49295779 GGGCTGGGCCGCTGCCGTCGAGG + Intronic
1096771731 12:53939655-53939677 CCCGAGCGCCGCCGCCGCCGGGG + Intronic
1096776373 12:53966811-53966833 AGGCAGCGCCGCAGCCGGCCCGG + Intergenic
1096789218 12:54034672-54034694 GGGCAGCGCCGACAGCCCCGCGG - Exonic
1096983740 12:55743399-55743421 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1097264420 12:57737514-57737536 CGCCACCGCCGCCGCCGCCGGGG - Exonic
1097929670 12:65169965-65169987 GGGCGCCTCCGCCGCCCCCGCGG + Exonic
1098255432 12:68611078-68611100 GCCCCGCGCGGCCGCCGCCGCGG - Intronic
1100391734 12:94150076-94150098 GGGAGCCGCCGCCGCCGCCGAGG + Intronic
1100444814 12:94650579-94650601 GCCCTGCGCCGCCGCCGCCGCGG + Intergenic
1100468946 12:94873522-94873544 GGGGAGCGCGGTCGCCCCCGGGG - Intergenic
1101371884 12:104138027-104138049 CGCCAACGCCGCCGCGGCCGGGG - Intronic
1101466923 12:104958361-104958383 GCGCAGCCGCGCCGCCGCCGGGG + Intronic
1101592898 12:106139193-106139215 CGCCGCCGCCGCCGCCGCCGTGG - Exonic
1101605885 12:106247623-106247645 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1102370948 12:112382090-112382112 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1102678075 12:114672066-114672088 GGGCCCCGCGGCCGCCGCCATGG + Exonic
1103410842 12:120710503-120710525 GGGCCCAGCCGCCGACGCCGCGG - Exonic
1103433026 12:120904104-120904126 CGGAGCCGCCGCCGCCGCCGCGG - Exonic
1103521249 12:121537912-121537934 AGCCGCCGCCGCCGCCGCCGAGG - Intronic
1103563597 12:121804674-121804696 GGCCGCCGCCGCCGCCGCGGCGG + Intronic
1103604879 12:122079017-122079039 GCGCCGCGCCACCGCCGCCTCGG + Exonic
1103649635 12:122422628-122422650 GTGACGCGCCGCCGCCGCCGCGG + Intronic
1105578038 13:21671023-21671045 AGGTAGCGCCGCCGCAGCCCGGG - Intergenic
1105943640 13:25171580-25171602 TGACAGCCCCGCCGCCGCCGCGG + Exonic
1106208405 13:27620500-27620522 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
1106517196 13:30465525-30465547 AGTCAGCGCGGACGCCGCCGGGG + Intronic
1107548961 13:41457728-41457750 GGGCAGCCCCGCGGCCGCCGCGG + Exonic
1107604014 13:42040754-42040776 GGCCGCCGCCGCCGCCGCCCCGG - Intronic
1108314094 13:49221008-49221030 GAACAGCGCCGCGGCCTCCGCGG - Exonic
1108389645 13:49936014-49936036 GCGCAGCGTCGCCGGCGCGGCGG + Intronic
1110596556 13:77326662-77326684 GAACAGCGCCCCCGGCGCCGGGG + Exonic
1111951318 13:94711551-94711573 TGCCGCCGCCGCCGCCGCCGCGG - Exonic
1112328276 13:98458542-98458564 GGGCCACGCCGCCGGCCCCGAGG + Intronic
1112505113 13:99970701-99970723 GTGCAGGGCGGCCGCCGCTGCGG + Exonic
1112507199 13:99982138-99982160 GGCAGCCGCCGCCGCCGCCGCGG - Exonic
1113378857 13:109785838-109785860 GGTCGGCGCCGCAACCGCCGCGG - Exonic
1113656099 13:112068501-112068523 GGCCGCCGCCGCCGCCGCTGCGG + Exonic
1113791265 13:113029645-113029667 GGGCAGCCCCGCCCCCACCTTGG - Intronic
1113995223 14:16058446-16058468 GGGCAGCACCGCCGCATCCTCGG + Intergenic
1114612521 14:24052102-24052124 AGGAGCCGCCGCCGCCGCCGGGG - Exonic
1115119874 14:29927191-29927213 GGGCAGCGCCCCCTGCGCCGCGG + Intronic
1115755015 14:36520751-36520773 GGCCAGCGCTCCAGCCGCCGGGG - Intronic
1116817862 14:49599795-49599817 CCGCGGCGCTGCCGCCGCCGCGG - Intronic
1117176687 14:53153029-53153051 AGGCGCCGCCGCCGCCGCCTCGG + Exonic
1118607700 14:67515405-67515427 CGCCGCCGCCGCCGCCGCCGGGG - Intronic
1118849479 14:69573085-69573107 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1118849561 14:69573470-69573492 GGGCACCGCCGCGGAGGCCGAGG + Exonic
1118971596 14:70642222-70642244 GGGCTCCTCCGCCGCCGCCCGGG - Exonic
1121050388 14:90816122-90816144 GGGGGGCGCCGCGGCCTCCGCGG - Intronic
1121050438 14:90816329-90816351 AGGCCCCACCGCCGCCGCCGCGG + Exonic
1121137170 14:91509785-91509807 GGGCCGCGCCGCCGCCTGCATGG + Exonic
1121617008 14:95319973-95319995 GGTCGGGGCCGCCCCCGCCGCGG + Intergenic
1122220976 14:100239065-100239087 GGGAAGCCCCGCCGCCGCCGCGG + Exonic
1122221037 14:100239216-100239238 GGGCTCCGCCGCCACGGCCGCGG - Exonic
1122390082 14:101374087-101374109 GGGCAGCCCGGCCGCAGCAGCGG - Intergenic
1122436803 14:101706261-101706283 GGGCGGCGCCGCCACGGCCTGGG - Intergenic
1122444991 14:101761696-101761718 CGCCGCCGCCGCCGCCGCCGTGG + Intergenic
1122623209 14:103071324-103071346 GGGCAGCGCCGCCAGCCCTGGGG - Intergenic
1122783730 14:104154536-104154558 GGGCAGCGCTGCCGTTGCAGAGG + Intronic
1122993283 14:105248924-105248946 CAGCAACGCCGGCGCCGCCGTGG + Exonic
1123024887 14:105419881-105419903 CGCCGCCGCCGCCGCCGCCGAGG - Exonic
1123036671 14:105474572-105474594 GGGCGGCGCCGCGGTCGCCCGGG + Intronic
1124128911 15:26967868-26967890 GGGTCCCGCCGCCCCCGCCGAGG + Intergenic
1124527582 15:30471288-30471310 CGGTGGCGCCGCCGCAGCCGTGG - Intergenic
1124771077 15:32536414-32536436 CGGTGGCGCCGCCGCAGCCGTGG + Intergenic
1125200754 15:37099072-37099094 CTGCTGCGCCGCTGCCGCCGTGG - Intronic
1125522938 15:40358259-40358281 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1126070558 15:44861830-44861852 GGGCTTGGCCGCCGCCGCCATGG + Intergenic
1126087459 15:45023282-45023304 GGGCTTGGCCGCCGCCGCCATGG - Exonic
1126134556 15:45378082-45378104 GGGCGGCGCCCCCTGCGCCGTGG + Intronic
1126697989 15:51341740-51341762 GAGCAGCGCCACGGCCGCCAGGG - Exonic
1128056541 15:64703454-64703476 GGGCCGCGCTGCCGCAGCTGCGG - Intergenic
1128067853 15:64775591-64775613 TGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1128119232 15:65133547-65133569 CGCCAGCGCCGCCTCCGCCGCGG + Exonic
1128171514 15:65517589-65517611 TGTCACCGGCGCCGCCGCCGAGG - Intronic
1128344127 15:66842819-66842841 GGGCGGCGGCGGCGCCGGCGCGG + Intergenic
1128453381 15:67819924-67819946 GGCCAGGGCCGCCGCCGCGCCGG + Intronic
1130076689 15:80695612-80695634 GGCTACCGCCGCCGCCGCCGCGG + Exonic
1130348015 15:83066896-83066918 TCGCGGCGCCGCCGCCGCTGGGG - Exonic
1130520681 15:84658471-84658493 GGGAAGCGGCTCCGCCGCCGGGG - Exonic
1131635799 15:94231706-94231728 GGGCAGCACGGTCGCCGCCTGGG + Intronic
1131735473 15:95326959-95326981 GCGGAGCGCCGCAGCCGCCGCGG - Intergenic
1131977511 15:97961041-97961063 GGGGCGCGCCACCGCCGCCTGGG + Exonic
1132055674 15:98648984-98649006 CCTCAGCGCCGCCGCCGCCGCGG - Exonic
1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG + Exonic
1132585806 16:705395-705417 GGGCCGCGCCGCCGCCGCCCGGG - Intronic
1132641876 16:981780-981802 CGCCGCCGCCGCCGCCGCCGAGG - Intergenic
1132662008 16:1065813-1065835 GGGCAGCGCATCCTCCGCGGAGG + Intergenic
1132793408 16:1706314-1706336 GGCCACCGCCGCCGCCAGCGCGG - Exonic
1133156559 16:3880444-3880466 CGGGGTCGCCGCCGCCGCCGCGG + Exonic
1133464737 16:6018967-6018989 CGCCAGCGCCGCCGCCGCCGCGG - Intergenic
1133784410 16:8963566-8963588 GGCCGCCGCCGCCGCCGCCGCGG + Intronic
1133924045 16:10180220-10180242 GGGCAGCCCCGCCGCCTGCTCGG + Exonic
1134143632 16:11742848-11742870 CGTCAGCCGCGCCGCCGCCGCGG + Exonic
1134149697 16:11796589-11796611 GGGCGGCGCCCCCGCCTCCGCGG + Intronic
1135135473 16:19883671-19883693 GGGCAGCGGCGTCCCCGCCTGGG - Intronic
1136556493 16:31010493-31010515 GGGGGGCGCCGCGGCCGCTGCGG + Exonic
1137412937 16:48244651-48244673 GGGCGGCGCGGCCTCCTCCGGGG + Intronic
1137683092 16:50368448-50368470 GGGCGGCGCCGCCGCACCCCCGG - Intronic
1138425961 16:56932226-56932248 CGACACCGCCGCCGCCGCCATGG + Exonic
1138478289 16:57284712-57284734 CGGCTCCGCCCCCGCCGCCGGGG + Intergenic
1139364826 16:66427039-66427061 CGGGAGCCGCGCCGCCGCCGAGG + Intergenic
1139364829 16:66427042-66427064 GAGCCGCGCCGCCGCCGAGGGGG + Intergenic
1139448673 16:67014075-67014097 ACGCAGCGCTGCCTCCGCCGCGG + Intergenic
1139637121 16:68264524-68264546 CGGTCGCGCCGCCGCCGCCGCGG - Intronic
1141054528 16:80803719-80803741 GGGGCGCGCCGCGGCCGGCGGGG - Intronic
1141054612 16:80804011-80804033 GGCCGCCGCCGCCGCCGCCGCGG + Intronic
1141132404 16:81445084-81445106 GGGCAGCGCCCCCTCCCCTGCGG + Intergenic
1141730798 16:85821601-85821623 GGGAAGCGCAGCAGCTGCCGGGG - Intergenic
1142225695 16:88876648-88876670 GGGCAGAGCCGCCGCGCCTGCGG + Exonic
1142395346 16:89828562-89828584 GGGCAGCTGCGGCGGCGCCGCGG + Exonic
1142896577 17:2983043-2983065 GGGCAGCAGCGCCGTCGCTGGGG + Intronic
1143099879 17:4499111-4499133 GAGCGGCGGCGCCGGCGCCGGGG + Exonic
1143583918 17:7842119-7842141 GCGCAGCGCCGCAGCCGCGCGGG - Intronic
1143697539 17:8631117-8631139 GCGCAGCGCGCCGGCCGCCGCGG - Intergenic
1144786859 17:17836876-17836898 AGGGAGCGCCGCCGCGGCCCCGG + Exonic
1146353147 17:32112664-32112686 GGCCAGCGCTGAGGCCGCCGCGG + Intergenic
1146398592 17:32487098-32487120 GCGCCGCGGCCCCGCCGCCGCGG - Exonic
1147193231 17:38748911-38748933 GGCCAGCGCCCCTGCCGCCGAGG - Intronic
1147661909 17:42121257-42121279 GGGCTGCGCAGCCGGGGCCGGGG + Exonic
1147720441 17:42536470-42536492 GCGCCGCGCCGCCGCCGCCCAGG - Exonic
1147742744 17:42678116-42678138 GGGCGGGGCCGCGGCCTCCGCGG + Intergenic
1147931488 17:43984097-43984119 GGGCCGCCCCGCCGCCCCCTCGG - Intronic
1148021807 17:44558234-44558256 GGGGAGCGCCGCCGCCGCCCGGG - Exonic
1148126934 17:45241982-45242004 GGGCAGCGGCGGCGCAGGCGGGG - Exonic
1148128075 17:45247058-45247080 GGGCAGCCCCTCCTCCGCTGTGG + Exonic
1148909223 17:50931635-50931657 GGGCAGCTCTGCAGCCGCGGGGG + Intergenic
1149461539 17:56833694-56833716 TGCCGGCGCCGCCGCCGCCGGGG - Exonic
1150003656 17:61456649-61456671 CGTCGTCGCCGCCGCCGCCGCGG + Exonic
1150643685 17:66965486-66965508 GGGCCGCGCCGGCACCCCCGGGG + Intronic
1150768284 17:68020078-68020100 GGCGCGCGCCGCCGCCGCTGGGG - Intergenic
1151858267 17:76737944-76737966 GGGCCGAGCGGCCGGCGCCGCGG + Exonic
1152049235 17:77959235-77959257 CGGAGCCGCCGCCGCCGCCGGGG + Intergenic
1152174926 17:78781611-78781633 GGGGAGCGGCGCCGCCGGCGAGG - Intronic
1152222209 17:79075059-79075081 GGCCGCCGCCGCCGCGGCCGCGG - Exonic
1152952808 18:10929-10951 GCGCAGCGCCGGCGCAGGCGCGG + Intergenic
1152952815 18:10958-10980 GCGCAGCGCCGGCGCAGGCGCGG + Intergenic
1152952822 18:10987-11009 GCGCAGCGCCGGCGCAGGCGCGG + Intergenic
1152952829 18:11016-11038 GCGCAGCGCCGGCGCAGGCGCGG + Intergenic
1152952836 18:11045-11067 GCGCAGCGCCGGCGCAGGCGCGG + Intergenic
1153040816 18:812015-812037 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1153514493 18:5891385-5891407 GGCCGCCGCGGCCGCCGCCGCGG - Exonic
1153565648 18:6414879-6414901 GGGCAGCGGCGCCGCAGCCTGGG - Intronic
1154173773 18:12068425-12068447 CCGCGCCGCCGCCGCCGCCGGGG + Intergenic
1154246317 18:12702728-12702750 AGTTGGCGCCGCCGCCGCCGGGG - Exonic
1154268212 18:12897117-12897139 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1155053825 18:22169044-22169066 GTCCCGCGCCGCCGCCGCGGCGG - Intergenic
1157614086 18:48976523-48976545 GCGGAGCGCCGCCGCCTCCCTGG + Intergenic
1157752711 18:50193837-50193859 CGGCAGCGCTGCAGCCGCCCGGG - Intronic
1157794249 18:50560040-50560062 AGCCTGCGCCGCCGCCGCCTCGG - Intergenic
1157867147 18:51197084-51197106 GCCCTGCGCCGCCGCTGCCGGGG + Exonic
1160024933 18:75209233-75209255 GGGCTGCGCCGGCGCCGGGGAGG - Exonic
1160164047 18:76495099-76495121 GGGCTGCGCCGCAGGGGCCGCGG - Intronic
1160455246 18:78994805-78994827 GGACAGCCCAGCCGCCGCCCCGG + Exonic
1160577249 18:79863688-79863710 GGGTCCCGCCGCCGCCGCCCGGG - Exonic
1160706345 19:531913-531935 GGGCCCCTCCGCCGCCGCCATGG + Exonic
1160754965 19:752265-752287 GGGCAGCGGCGCTGCCCTCGGGG - Intronic
1160967715 19:1753875-1753897 GGGCAGCGCGGGCGGCGGCGCGG + Exonic
1160991603 19:1862583-1862605 GAACCGCGTCGCCGCCGCCGGGG - Intronic
1161069073 19:2251516-2251538 GGGGATCGCCGAGGCCGCCGGGG - Exonic
1161175989 19:2842162-2842184 GGGCGTCTCCGCCCCCGCCGAGG - Intronic
1161703246 19:5805938-5805960 GCTCGCCGCCGCCGCCGCCGGGG + Intergenic
1162033203 19:7926049-7926071 GGCCGCCGCCGCCGCCGCCGGGG - Exonic
1162751759 19:12833852-12833874 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1162909795 19:13842703-13842725 TGCCGGCGCCGCTGCCGCCGAGG + Intergenic
1163154474 19:15432492-15432514 CGCCACCGCCACCGCCGCCGCGG - Intronic
1163250686 19:16124825-16124847 GGGCAGCCCCGCCTCAGCCTGGG - Intronic
1163320476 19:16571904-16571926 GGGCCCGGCCGCCGCCCCCGAGG + Intronic
1163513076 19:17747711-17747733 CGGCAGCCGCGCCGCAGCCGCGG + Exonic
1163583710 19:18153202-18153224 GGCCACCGTCGCCGCAGCCGCGG - Exonic
1163606979 19:18280983-18281005 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
1163612763 19:18309681-18309703 GGCCAGCGCCGCCCATGCCGCGG + Exonic
1163625668 19:18388166-18388188 GTGCAAAGGCGCCGCCGCCGTGG + Intronic
1163631398 19:18419623-18419645 GCTCCACGCCGCCGCCGCCGGGG - Exonic
1163807252 19:19406450-19406472 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1164834724 19:31349760-31349782 GGGACGCGCAGCCGCCGCCGCGG + Intergenic
1165080258 19:33302610-33302632 GCGCCGCGCCGCCGCAGCCCGGG - Intergenic
1165157228 19:33796057-33796079 GAGGAGAGCAGCCGCCGCCGCGG - Intronic
1165803167 19:38565320-38565342 GAGCAGCGCCGCCACTGCGGTGG - Exonic
1166361253 19:42253868-42253890 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
1166736946 19:45091584-45091606 TCGCAGCGCCGGCTCCGCCGAGG + Intronic
1166749662 19:45158887-45158909 GGGCAGAGCCGCTGCCGCAGGGG + Exonic
1166869905 19:45864717-45864739 GGGCAGCCTCGCCGCGGCCAGGG + Intronic
1167045386 19:47046196-47046218 GGGCAGCGCCTCGTACGCCGTGG - Exonic
1167238617 19:48330185-48330207 GGGCAGCGCCGCTGCCTGCTGGG - Intronic
1167268232 19:48493819-48493841 GAGCAGCGCCGACGCGGACGCGG - Exonic
1167535833 19:50050798-50050820 GGGCAGCGTCGCCACCAACGTGG - Intronic
1168064056 19:53909423-53909445 GGCCGCCGCCGCCGCCACCGGGG - Exonic
1168115599 19:54220112-54220134 GGGGAGCGCCGCCTCCCCCAGGG - Intronic
1168118586 19:54239858-54239880 GGGGAGCGCCGCCTCCCCCAGGG - Intronic
1168144908 19:54415515-54415537 GGGCAGCGGGGCGGACGCCGGGG - Exonic
1168339113 19:55613773-55613795 GGGCAGGGCCGCCACCGCCTTGG - Exonic
1168643345 19:58044512-58044534 GCGAAGAGCCGCGGCCGCCGCGG + Intronic
1202683781 1_KI270712v1_random:31100-31122 TTGCATCCCCGCCGCCGCCGTGG + Intergenic
925928339 2:8685882-8685904 GGGCAGCGCGGCTGGCGCCGCGG - Intergenic
927215352 2:20665524-20665546 GGTCAGCGCTGCCGGCGCTGAGG - Intergenic
927544499 2:23940661-23940683 GGGCCGCGCCGCGTCCGGCGGGG + Intronic
927596574 2:24402959-24402981 GGCCAGGGCCGCCAGCGCCGGGG + Intergenic
927881457 2:26692709-26692731 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
927904525 2:26847659-26847681 GGGCAGCGCGGCCGCAGCCCGGG + Intergenic
927935022 2:27071550-27071572 GGCCAGCCCCGCCGTGGCCGTGG - Intronic
927938154 2:27086744-27086766 GGGCGGGGCCGCCGCGACCGCGG + Exonic
929983223 2:46699578-46699600 GGCCGGCGCTGCCTCCGCCGCGG - Intronic
931254111 2:60555286-60555308 AGCCGCCGCCGCCGCCGCCGGGG + Intergenic
931695173 2:64865716-64865738 GGGGCGCTGCGCCGCCGCCGAGG - Intergenic
932621871 2:73269465-73269487 CGACGGCGCCGCCGCCGCCGCGG - Exonic
932699849 2:73985058-73985080 GGCCGCCGCCGCCGCCGCCTGGG - Intergenic
933666860 2:84971283-84971305 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
934247909 2:90323715-90323737 TTGCATCCCCGCCGCCGCCGTGG - Intergenic
934248169 2:90324632-90324654 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248184 2:90324693-90324715 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248358 2:90325306-90325328 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248369 2:90325344-90325366 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248380 2:90325382-90325404 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248396 2:90325446-90325468 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934261467 2:91479094-91479116 TTGCATCCCCGCCGCCGCCGTGG + Intergenic
934304465 2:91809922-91809944 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
934328792 2:92042828-92042850 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
935112318 2:100104804-100104826 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
935196646 2:100820245-100820267 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
935592441 2:104855292-104855314 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
935592574 2:104855669-104855691 GGGCAGCGCCGCCGTGACCTCGG + Exonic
935592782 2:104856389-104856411 CGCCGCCGCCGCCGCCGCCGTGG - Exonic
935692680 2:105745071-105745093 GCGCAGCGCGGCCACCGCCCCGG + Exonic
937237986 2:120442153-120442175 TGGCAGCGCCGCGGCCTCCCTGG - Intergenic
937273510 2:120670123-120670145 GGGAAGGGCCGCAGCCGCTGAGG - Intergenic
938795850 2:134718243-134718265 GGGCAGCCGGGCGGCCGCCGAGG + Intronic
940265134 2:151828359-151828381 AGGCCCCGCCGCTGCCGCCGCGG + Exonic
940775180 2:157876642-157876664 GGCCTGCCCCGCCGCCTCCGAGG - Intergenic
941580696 2:167293121-167293143 CGGCAGCGCCGGCGGCGCGGCGG - Intergenic
942046552 2:172102430-172102452 GGCCGGCGCCGCCGCCGCTCGGG + Exonic
942241115 2:173964682-173964704 CGCCGCCGCCGCCGCCGCCGGGG - Intronic
942450899 2:176107580-176107602 TGCCGCCGCCGCCGCCGCCGCGG - Exonic
942453547 2:176123025-176123047 GCTCATCGCCGCCGCTGCCGGGG - Exonic
942560357 2:177212842-177212864 GGCCGTCGCCGTCGCCGCCGGGG + Exonic
943185165 2:184598312-184598334 GCGCGGCGCCGCTGCCGCAGAGG - Intergenic
943571506 2:189580771-189580793 CGCCGCCGCCGCCGCCGCCGTGG + Exonic
943669872 2:190649112-190649134 AGGAGCCGCCGCCGCCGCCGCGG + Intronic
944831219 2:203535342-203535364 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
945404037 2:209423907-209423929 TGGCAGCGCCAGCCCCGCCGCGG + Intergenic
945466017 2:210171322-210171344 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
946248566 2:218400231-218400253 GGGAGCCGCCGCCGCCGCCCCGG + Intronic
946322087 2:218960153-218960175 TGGCGGTGCCGCCGCCGTCGGGG - Exonic
946354860 2:219178291-219178313 GGGCTGCGCGGCCGCCGCCGGGG - Exonic
946865594 2:224039052-224039074 GGGCAGCGCCGGCCGCGCCCGGG + Intronic
946921520 2:224585490-224585512 GGGGAGCCCGGCGGCCGCCGCGG + Intergenic
947538537 2:230957546-230957568 GCCCAGCACCGCCGGCGCCGCGG - Intronic
947605434 2:231482913-231482935 TGGCAGCGCCGCGGCAGCCCGGG + Intronic
947876134 2:233469433-233469455 CCGCAGCGCCCCCGCCGTCGAGG + Exonic
948193211 2:236075981-236076003 GGGCGGCACCGCCTCCGCCTGGG - Intronic
948438130 2:237967399-237967421 GTCCCCCGCCGCCGCCGCCGCGG - Intronic
948463037 2:238139346-238139368 GGGCAGAGCCGCCTTCACCGGGG + Intronic
948805710 2:240452815-240452837 GGGCAGCGCCGCAGCCGCACTGG - Intronic
1169171690 20:3470770-3470792 GGGCTGCAACCCCGCCGCCGGGG + Intergenic
1169214727 20:3786510-3786532 CGGCGCCGCCGCCGCCGCCCCGG + Exonic
1169278558 20:4249133-4249155 GGGGAGCCCGGCCGCCGCCCGGG - Intergenic
1170617804 20:17968481-17968503 GGCCGCCGCCGCCGCCGCCTGGG + Intronic
1171977590 20:31605405-31605427 CAGCACCGCCACCGCCGCCGCGG + Exonic
1172100891 20:32483564-32483586 CGGCAGCGGCGGCGGCGCCGCGG + Intronic
1172239266 20:33401403-33401425 GAGCAGCGCGGCCGCCGGGGTGG - Intronic
1172502097 20:35434631-35434653 GGGCAGCCCGCCCGCCTCCGGGG + Exonic
1173672875 20:44810298-44810320 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1173803732 20:45911092-45911114 GGGCCCCGCCTCCACCGCCGAGG + Intronic
1174287771 20:49484198-49484220 AGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1174317413 20:49713534-49713556 GGCCAGAGCGGCAGCCGCCGCGG + Intronic
1174506948 20:51023115-51023137 GCGCGGCGCAGCAGCCGCCGAGG + Exonic
1175267155 20:57709803-57709825 GGGCACTGCCGACGCCCCCGGGG - Exonic
1175844419 20:62051147-62051169 GGGCAGCCCCGCAGGCGCTGGGG + Intronic
1175847000 20:62064788-62064810 CGGCTGCGGCGCCGGCGCCGGGG - Exonic
1176014936 20:62926221-62926243 GGTCAGAGCCGCCGCGGCCTGGG - Intronic
1176125393 20:63472659-63472681 GGGCGGAGCCGGCGCGGCCGCGG - Intergenic
1176546670 21:8205331-8205353 GGGCAGCCCCACGCCCGCCGCGG - Intergenic
1176548360 21:8211521-8211543 GCGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176548596 21:8212230-8212252 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176550033 21:8217047-8217069 GGACCGTGCCCCCGCCGCCGGGG - Intergenic
1176550079 21:8217163-8217185 GGGCGTCGCGGCCGCCCCCGGGG + Intergenic
1176554565 21:8249521-8249543 GGGCAGCCCCACGCCCGCCGCGG - Intergenic
1176556251 21:8255724-8255746 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176556490 21:8256438-8256460 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176565621 21:8388378-8388400 GGGCAGCCCCACGCCCGCCGCGG - Intergenic
1176567291 21:8394556-8394578 GCGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176567527 21:8395265-8395287 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176568960 21:8400082-8400104 GGACCGTGCCCCCGCCGCCGGGG - Intergenic
1176569006 21:8400198-8400220 GGGCGTCGCGGCCGCCCCCGGGG + Intergenic
1176573486 21:8432546-8432568 GGGCAGCCCCACGCCCGCCGCGG - Intergenic
1176575190 21:8438766-8438788 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176575429 21:8439480-8439502 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176576874 21:8444317-8444339 GGACCGTGCCCCCGCCGCCGGGG - Intergenic
1176576920 21:8444433-8444455 GGGCGTCGCGGCCGCCCCCGGGG + Intergenic
1177011053 21:15730366-15730388 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1178513837 21:33229905-33229927 GCGCCGCGCCGCCGCCGGCGCGG - Intronic
1178534966 21:33403585-33403607 AGTCTTCGCCGCCGCCGCCGCGG + Exonic
1180014698 21:45074555-45074577 GGGCGGAGCCGCCGGCGGCGGGG + Intronic
1180159711 21:45993599-45993621 GGCCAGAGTCGCCGCCACCGAGG + Intronic
1180311869 22:11248963-11248985 GGGCAGCACCGCCGCATCCTCGG - Intergenic
1180618139 22:17141914-17141936 GGGCAGCACCGCCCCTGCTGAGG + Intronic
1180650003 22:17369665-17369687 GCGCCCCGCCGCCCCCGCCGAGG + Exonic
1180871703 22:19150292-19150314 CGGCCGGGGCGCCGCCGCCGCGG + Intergenic
1180871733 22:19150412-19150434 AGGCAGGGCCGCCGCAGTCGAGG - Intergenic
1180949546 22:19714931-19714953 GGGCAGTGCCGCCGCGCCTGGGG + Intronic
1181026853 22:20131825-20131847 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1181457939 22:23070309-23070331 GCGCCGCGCCGCCGCCGGCAGGG - Intronic
1181902675 22:26169311-26169333 TGGCACCCCCGGCGCCGCCGCGG + Intergenic
1182236912 22:28883501-28883523 GGCCTCCGCAGCCGCCGCCGTGG - Intergenic
1182237005 22:28883818-28883840 CGCCTGCGCCGCCGCCCCCGCGG + Exonic
1182296829 22:29315054-29315076 GGCCAGCGACGTCGCCGTCGCGG + Exonic
1182308624 22:29388693-29388715 TAGCAGCGCCGCGGCTGCCGAGG - Intronic
1182903725 22:33920047-33920069 CGGCGGCGCCGCCGCCTACGAGG + Exonic
1183095794 22:35551611-35551633 GGGCAGCTCCGCCGCCTCCTTGG - Exonic
1183466705 22:37983794-37983816 GGCCGCCGCCGCCGCCGCCTCGG + Exonic
1184222768 22:43111208-43111230 GGGCTGTGCGGCCGCGGCCGTGG - Intronic
1185032333 22:48450611-48450633 GGGCAGCGCCACCCACCCCGAGG - Intergenic
1185055204 22:48575680-48575702 AGCCCGCGCCTCCGCCGCCGCGG - Intronic
1185313824 22:50170433-50170455 GCGCTCCGCCGCCGCCCCCGGGG - Intergenic
1185374291 22:50474964-50474986 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1203238467 22_KI270732v1_random:30913-30935 CGCCGCCGCCGCCGCCGCCGGGG + Intergenic
1203251535 22_KI270733v1_random:121597-121619 GGGCAGCCCCACGCCCGCCGCGG - Intergenic
1203253239 22_KI270733v1_random:127821-127843 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203254923 22_KI270733v1_random:133373-133395 GGACCGTGCCCCCGCCGCCGGGG - Intergenic
1203254969 22_KI270733v1_random:133489-133511 GGGCGTCGCGGCCGCCCCCGGGG + Intergenic
1203261294 22_KI270733v1_random:172902-172924 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203261534 22_KI270733v1_random:173613-173635 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1203262979 22_KI270733v1_random:178452-178474 GGACCGTGCCCCCGCCGCCGGGG - Intergenic
1203263025 22_KI270733v1_random:178568-178590 GGGCGTCGCGGCCGCCCCCGGGG + Intergenic
950316347 3:12004745-12004767 GGGCTGCGGCGCGGGCGCCGAGG - Exonic
951217700 3:20040420-20040442 AGGCGCCGCCGCCGCCGCCAGGG - Exonic
951907896 3:27721913-27721935 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
953947773 3:47164011-47164033 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
954553337 3:51499876-51499898 GGGCAGCGGCGGAGCCGCCTCGG - Exonic
954763994 3:52897645-52897667 GGGGAGAGCTGCCGCGGCCGAGG - Intergenic
955911573 3:63863958-63863980 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
956658976 3:71581620-71581642 GGGCAGCGGCAGCGGCGCCGGGG - Intronic
956659154 3:71582371-71582393 CGGCGCCGCCGCCACCGCCGTGG + Intronic
956678016 3:71753646-71753668 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
957028634 3:75214592-75214614 GGCCGTCGCCGTCGCCGCCGGGG + Intergenic
959530731 3:107431535-107431557 GGTCACCGCCGCCGCCGCCGGGG + Intergenic
961674404 3:128555844-128555866 GCCCAGCGCCGCAGCCGCTGCGG - Intergenic
961739986 3:129027247-129027269 GAGCACCGCCGCCGCCCGCGGGG - Intronic
961827254 3:129605646-129605668 TGGCGTCGCCGCCGGCGCCGTGG + Exonic
963133248 3:141877036-141877058 GCACTGCGCCGCCGCCGCCCGGG - Intronic
963904455 3:150762657-150762679 CGGCCCCGCCGCCGCCGCCGGGG + Exonic
963939893 3:151087101-151087123 GGGCATCGCCGGCGCTGCGGTGG + Intronic
964801632 3:160565019-160565041 GGCCTGCTCCGCCTCCGCCGGGG - Intronic
966182200 3:177197562-177197584 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
966201075 3:177359896-177359918 CGGCAGCGACCCCGACGCCGCGG + Intergenic
966362829 3:179148527-179148549 GGGCGGCGGCGGCGGCGCCGAGG - Exonic
966866097 3:184259955-184259977 GGTCCGCGCCGCCGCTACCGCGG + Exonic
967493781 3:190120994-190121016 TGGCAGCCCCGCCGCTGCAGCGG - Intronic
968671781 4:1855998-1856020 GCGAAGAGCCGCGGCCGCCGCGG - Exonic
968701299 4:2059400-2059422 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
968775201 4:2536237-2536259 AGGCCGCGCCGCCGCCCGCGAGG - Intronic
968775449 4:2537019-2537041 GCGCAGCGCCGCCGCCGGGCCGG - Intronic
969021705 4:4143552-4143574 GGGCGGCGCCTCCTCCTCCGCGG + Intergenic
969379107 4:6782805-6782827 GGGCGGCGCGGCGGCCGGCGGGG - Exonic
969732162 4:8963863-8963885 GGGCGGCGCCTCCTCCTCCGCGG - Intergenic
969873082 4:10116606-10116628 GGGCAGCGCGGCGGCCGCTCGGG + Intronic
970195213 4:13544911-13544933 GGCTACCGCCGCCGCCGCCGGGG - Exonic
970333032 4:15003782-15003804 GGGCAGCGGCGGCGGCGACGCGG - Exonic
970456350 4:16226993-16227015 GAGCCGGGCCCCCGCCGCCGCGG - Intronic
971457809 4:26860794-26860816 CTCCCGCGCCGCCGCCGCCGCGG - Intronic
972321553 4:37977360-37977382 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
973137316 4:46724426-46724448 GCGCCCTGCCGCCGCCGCCGCGG - Intergenic
974549287 4:63349845-63349867 GGCCAGTGCCGCCGCTGCTGCGG + Intergenic
975166715 4:71186589-71186611 GAGCCGCGCCGCCTCCGCCGGGG - Intergenic
976431241 4:84966002-84966024 GGGAGCCGCCGCCGCCGCCAGGG - Intronic
976600712 4:86935286-86935308 GGCCCCCGACGCCGCCGCCGCGG + Intronic
978072626 4:104491565-104491587 CAGCAGCGCCGCCGCCGCCGCGG - Exonic
978529946 4:109703094-109703116 GAGTAGCGACGCCGGCGCCGGGG - Intronic
978777204 4:112516020-112516042 GGCCGCCGCCGCCGCCGCCGGGG - Exonic
979547168 4:121951565-121951587 GAGCCGCAGCGCCGCCGCCGGGG - Exonic
980541439 4:134201523-134201545 TGCAGGCGCCGCCGCCGCCGAGG + Intronic
980628843 4:135408392-135408414 GGGCAAAGCCGCCGCCGCCACGG + Intergenic
980969407 4:139555613-139555635 GGACGGGGCCGCGGCCGCCGCGG + Intronic
982712205 4:158768942-158768964 CCGCGCCGCCGCCGCCGCCGTGG + Intergenic
982745990 4:159104017-159104039 GCCCCGCGCCGCCGCCGCCGCGG + Intergenic
984462995 4:180059167-180059189 GAGCGGAGCCGCCGCCGCCGCGG - Intergenic
984823625 4:183905820-183905842 GAGCAGCGCTGCCGCCGCGCGGG + Exonic
985452218 4:190068423-190068445 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
985453202 4:190071720-190071742 GTGCAGCGCGGCCCCCGGCGGGG + Exonic
985454192 4:190075013-190075035 GTGCAGCGCGGCCCCCGGCGGGG + Exonic
985455180 4:190078306-190078328 GTGCAGCGCGGCCCCCGGCGGGG + Exonic
985456168 4:190081606-190081628 GTGCAGCGCGGCCCCCGGCGGGG + Exonic
985457152 4:190084900-190084922 GTGCAGCGCGGCCCCCGGCGGGG + Intergenic
985458139 4:190088193-190088215 GTGCAGCGCGGCCCCCGGCGGGG + Exonic
985459128 4:190091493-190091515 GTGCAGCGCGGCCCCCGGCGGGG + Exonic
985463381 4:190174262-190174284 GTGCAGCGCGGCCCCCGGCGGGG + Exonic
985679257 5:1247332-1247354 GGGCAGCTCCCCCCCTGCCGTGG - Intergenic
986330517 5:6713641-6713663 GTGGAACGCCGCCGCCGCCGCGG + Intergenic
986330706 5:6714216-6714238 GGGCAGCGCGGCGGGCGCGGTGG - Intergenic
986330851 5:6714717-6714739 GGGCCCCGCCCCCGCCCCCGCGG - Intronic
986813660 5:11385161-11385183 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
988993078 5:36690254-36690276 GGGAAGCGCGGCCGCTGCGGAGG - Intergenic
990210788 5:53480238-53480260 CGGCAGCGCCGGCGCGCCCGGGG - Intergenic
990825486 5:59893553-59893575 GGGCAGCGACAGCGCCGGCGGGG - Exonic
990955144 5:61332803-61332825 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
992105504 5:73447160-73447182 TGGCGGCGCCGCCACCGGCGAGG + Exonic
993901219 5:93585113-93585135 CGGCGCCGCCGCCGCCGCCGCGG - Exonic
994353071 5:98769037-98769059 AGGCAGCGCCGCCGGCCCGGAGG + Intronic
994353873 5:98774015-98774037 GGGCGGCGGCGCGGGCGCCGTGG - Exonic
995206588 5:109487803-109487825 GGGCAGCTCCGCCTGCGCCCTGG - Intergenic
996552350 5:124744197-124744219 TGGCAGCGTCGCCGCTGCAGGGG - Exonic
997302078 5:132813630-132813652 GGCCGCCGCCGCCGCCGCTGCGG + Exonic
997975375 5:138438957-138438979 GGGGCGCGCCGCCGCCGCCGCGG + Intergenic
997975376 5:138438960-138438982 GCGCGCCGCCGCCGCCGCGGCGG + Intergenic
997990809 5:138543147-138543169 CGTCAGAGCCGCCGCCGCCGCGG - Exonic
998143151 5:139711048-139711070 GGGAAGCGCTCCCGCCGCCTGGG - Intergenic
998166675 5:139848292-139848314 GCGCGCCCCCGCCGCCGCCGCGG - Exonic
998374516 5:141682065-141682087 GGGGAGGGCCGCCGGCGCCGAGG + Intronic
998435918 5:142108795-142108817 AAGCACCGCCGCCGCCGCCGAGG - Exonic
1001496198 5:172188854-172188876 GGGCAACGCCGGTGCAGCCGCGG + Intergenic
1002061986 5:176630546-176630568 GGGCGGCGCGGCCGCCAGCGGGG - Intronic
1002190135 5:177473595-177473617 GGGAGTCGCCGCCGCCGCCTCGG + Intronic
1002927148 6:1611183-1611205 GGGCAGCGGCAGCGCCGCCGCGG + Exonic
1003049234 6:2765354-2765376 GCGAGGCGCCTCCGCCGCCGGGG + Intergenic
1003325191 6:5085547-5085569 GGGCAGCTCCTCGGCCGGCGGGG - Exonic
1003551833 6:7107683-7107705 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1004193872 6:13487271-13487293 GGGCTGCGGCGGCGCGGCCGCGG - Exonic
1004193874 6:13487274-13487296 CGGCCGCGCCGCCGCAGCCCGGG + Exonic
1004650249 6:17600885-17600907 GGGCGGCGGCGCCGCGGCCTGGG - Exonic
1004864281 6:19837873-19837895 TGCCGCCGCCGCCGCCGCCGCGG - Exonic
1006725402 6:36196504-36196526 AGGCGCCGCCGCCGCCGCCACGG - Intergenic
1008932467 6:56954927-56954949 GAGGAGCAGCGCCGCCGCCGCGG + Intergenic
1010107082 6:72182664-72182686 CGGCAGCGCCGCGCCCGCCTCGG - Exonic
1011607373 6:89118093-89118115 GGGCGGCGCCGGCGCGGCCCAGG + Intergenic
1012399998 6:98835071-98835093 CGCCCCCGCCGCCGCCGCCGTGG - Exonic
1013273255 6:108561081-108561103 GGGCGCCGCCGCCGCCGCCTGGG - Exonic
1013507599 6:110815351-110815373 GGGAGCCGCCGCCGCCGTCGCGG - Intronic
1013575803 6:111482958-111482980 GGGCGCCGCCGCCGCTGCGGAGG - Exonic
1013575804 6:111482961-111482983 AGGGGGCGCCGCCGCCGCTGCGG - Exonic
1013793674 6:113860399-113860421 GGCCAGCGCCGCCGCCTGCGAGG + Exonic
1013836548 6:114342201-114342223 CGCCCGCGCCGCCACCGCCGGGG - Exonic
1014632525 6:123803871-123803893 TGGCAGCGCCGCCGCGCCCTCGG - Intergenic
1017672242 6:156778733-156778755 CGCCTCCGCCGCCGCCGCCGGGG + Exonic
1017877682 6:158537344-158537366 TGGCGGCGCCCCCGCCTCCGAGG - Intronic
1018945570 6:168345472-168345494 GGGCTGCGCCGCCTCCCCTGGGG + Intergenic
1019262397 7:88770-88792 GGGCAGGGCTGCAGCCGCGGAGG - Intergenic
1019343753 7:519994-520016 GGGCCCGGGCGCCGCCGCCGCGG + Intronic
1019421801 7:954267-954289 GTTCAGCGCCGCCACCCCCGCGG + Intronic
1019421804 7:954281-954303 GGGGAGCGCGGACGCCGCGGGGG - Intronic
1019472877 7:1230425-1230447 CCGCGGCGCCGCCGCAGCCGAGG + Intergenic
1019474246 7:1236431-1236453 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1019663909 7:2241944-2241966 GGGCAGGGCCGGCGGGGCCGTGG - Intronic
1020238524 7:6374696-6374718 GCGCCCTGCCGCCGCCGCCGCGG + Exonic
1021451251 7:20785336-20785358 GGGCAGCGGCGGCGGCGGCGGGG - Exonic
1022100248 7:27165146-27165168 GTCCGGCGCCGCCGCCGCCACGG + Exonic
1022427951 7:30285543-30285565 CGGCGGCGCCGCGGCGGCCGCGG + Exonic
1022698006 7:32728684-32728706 GGGCCGGGGGGCCGCCGCCGCGG + Intergenic
1023000346 7:35801534-35801556 GCGCAGAGCCGCGGCCTCCGCGG + Intronic
1023965976 7:44963230-44963252 GGGGAGCGCCGCCCTCGCCAGGG + Intronic
1024043765 7:45574291-45574313 TCGCAGCGCGGTCGCCGCCGAGG + Intronic
1024596075 7:50938981-50939003 GGGCAGGGGCGCCGCCGAGGTGG - Intergenic
1025069681 7:55887599-55887621 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1025615709 7:63114426-63114448 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1027218925 7:76201951-76201973 GGGCAGCTCCGCGGCCCCCACGG - Exonic
1027421340 7:78020131-78020153 GGGCAGCGGCCGCGCCCCCGGGG + Intronic
1029123113 7:98281505-98281527 GTGCAGAGGCGCCGCCGGCGGGG + Intronic
1029640258 7:101815903-101815925 GGCCGCCGCCGCCGCCACCGAGG - Intronic
1029996754 7:105014154-105014176 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
1031043568 7:116862977-116862999 GGGCCGCGGGGCCTCCGCCGGGG + Intronic
1031051885 7:116953446-116953468 TCGCGCCGCCGCCGCCGCCGCGG - Exonic
1031134832 7:117873329-117873351 GGTTACCGCCGCCTCCGCCGCGG + Exonic
1032174359 7:129611698-129611720 TGCCGCCGCCGCCGCCGCCGAGG - Exonic
1032306114 7:130733793-130733815 GCGCGGCGCCGCCCGCGCCGGGG + Exonic
1032791533 7:135246473-135246495 GGGCAGCGCCGCCTCCTGCGGGG - Exonic
1033159086 7:138981241-138981263 GGGGCGCGGCGCCGACGCCGAGG - Exonic
1033186507 7:139231627-139231649 GGGCGGAGCCGCCGGCCCCGCGG + Exonic
1033288591 7:140062661-140062683 GGGCGGCGCAGCCGCGGCCCCGG - Exonic
1033299992 7:140176911-140176933 GGCCACCGCCGCCGCCGCTCCGG + Exonic
1033300013 7:140177026-140177048 CTGAGGCGCCGCCGCCGCCGCGG - Exonic
1033477131 7:141702033-141702055 GGGCGCCCCCGCCGCCGCCCCGG + Exonic
1034147257 7:148884212-148884234 CGCCGCCGCCGCCGCCGCCGGGG + Exonic
1034263701 7:149771948-149771970 GGGGAGCGCTGCCGCCGAGGCGG - Intronic
1034469722 7:151248756-151248778 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1034589688 7:152128883-152128905 GGGCAGCCCCACCGCCGCTGTGG + Intergenic
1034977739 7:155457987-155458009 GGGCTCCGGCGCCGCCGCCTGGG - Intergenic
1035168168 7:157003706-157003728 GGGCCGGGCCTCCGCCGCCTGGG - Intronic
1035266104 7:157691014-157691036 GAGCCGCGCCGCCGCCGGCCGGG - Intronic
1035431707 7:158828446-158828468 GGGCAGGGCCGCGGCCGAAGAGG + Intronic
1035453293 7:158992896-158992918 GGGCAGCTCCTCCGTCGTCGGGG + Intergenic
1035553015 8:544655-544677 GGCCGCCGCCGCCGCCGCCCAGG - Exonic
1035747780 8:1974162-1974184 GGGCAGCGCTGCCCGCGGCGGGG + Intronic
1036032710 8:4991675-4991697 GCCCAGCGCCGACGCCCCCGGGG + Intronic
1036723729 8:11201069-11201091 CCGCAGCGCCGCCGCCGACGGGG - Exonic
1036788996 8:11705168-11705190 GGGCAGCGCGGCCCGCACCGTGG + Intronic
1036789498 8:11708666-11708688 GGCCGCCGCCGCCGCTGCCGCGG + Exonic
1036930461 8:12951508-12951530 GGGCCGCGCCCGCCCCGCCGGGG - Intronic
1038429852 8:27491318-27491340 GCCCAGCGCCGCCGCCGCAGTGG + Intronic
1039454296 8:37697294-37697316 GGGCGCCGCCTCCGCAGCCGCGG + Exonic
1041059501 8:54022275-54022297 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1041689916 8:60678763-60678785 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1044719849 8:95134294-95134316 GGACGCCGCCGCCGCCGCGGGGG + Intronic
1044832261 8:96261858-96261880 GGGTCGCGGCGCCGCCACCGCGG - Exonic
1045118739 8:99012967-99012989 GGGAACCGCCGCCGGCGCAGCGG + Intergenic
1045516297 8:102863628-102863650 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
1047961659 8:130016076-130016098 GCGCAGCGGGGCCGCCGCCCGGG - Intronic
1049109852 8:140635788-140635810 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1049194520 8:141308115-141308137 CGGCCGCCCCGCCGCCCCCGCGG - Intronic
1049585086 8:143429309-143429331 AGCCCGCGCCGCCGTCGCCGGGG - Exonic
1049693713 8:143973615-143973637 GGGCGGGGCCGGGGCCGCCGCGG + Intronic
1049746467 8:144265274-144265296 GTGCAGCTCCGGCGCCTCCGAGG - Intronic
1049759727 8:144326561-144326583 CCGCAGGCCCGCCGCCGCCGTGG + Exonic
1049762199 8:144336653-144336675 GCCCGGCGCCGCCGCCCCCGGGG - Intergenic
1049989395 9:977282-977304 TGCCAGGGCCCCCGCCGCCGGGG + Exonic
1050230921 9:3525589-3525611 CCGCTGCGGCGCCGCCGCCGAGG - Intronic
1051079694 9:13279665-13279687 GGGCCCCGCCACCGCCTCCGCGG - Intergenic
1051171496 9:14322462-14322484 GGGCAGCCCCGCCGCGGGCCAGG - Intronic
1052362212 9:27573442-27573464 CGCCTGCGCCTCCGCCGCCGCGG + Intronic
1053697501 9:40651086-40651108 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1054308790 9:63450486-63450508 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1054781992 9:69174194-69174216 GGCTGACGCCGCCGCCGCCGCGG + Intronic
1054798638 9:69325424-69325446 GGCCAGCGCGGCCGCAGCGGGGG - Intronic
1054835655 9:69672554-69672576 CGGTGCCGCCGCCGCCGCCGCGG - Intergenic
1054842665 9:69760045-69760067 AGGCCGCGTCCCCGCCGCCGCGG + Intergenic
1055090996 9:72364835-72364857 AGGTGGCGCCGCCGCCGCCGCGG + Intronic
1055091114 9:72365281-72365303 CGCCGCCGCCGCCGCCGCCGGGG - Intergenic
1055514227 9:77020407-77020429 GGCCGCCGCCGCTGCCGCCGCGG + Exonic
1055936835 9:81611801-81611823 GATGAGCGCCGCAGCCGCCGCGG - Exonic
1057361146 9:94374747-94374769 GGGCACCGCCGCCGCCTCCGCGG + Exonic
1057483189 9:95461802-95461824 GGGCAGCGGCCCCGCAGCCCTGG + Intronic
1057489144 9:95508367-95508389 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1057489270 9:95508871-95508893 GCGCAGAGCCGCCGCCGCCGCGG + Intronic
1057573144 9:96219166-96219188 GGGCAGCGCGGCCGCAGCGCGGG - Intergenic
1057623268 9:96655230-96655252 GGTTAGCGGCGCCGCCGCCCTGG - Exonic
1057662215 9:97013417-97013439 GGGCACCGCCGCCGCCTCCGCGG - Exonic
1060209083 9:121699426-121699448 GAGCGCCGCCGCCGCCGCCGCGG + Exonic
1060389799 9:123268217-123268239 GGCCGCCGCCGCCGCCGCTGCGG - Intronic
1061196658 9:129110563-129110585 AGTCCGCGCCGCCGCCGCCGCGG + Exonic
1061583907 9:131554576-131554598 CGGCAGCCCCGCCACCCCCGAGG + Intergenic
1061961850 9:133992630-133992652 GGGGCGCCCCGCGGCCGCCGCGG + Intergenic
1062305905 9:135907126-135907148 GAGCGGCCGCGCCGCCGCCGAGG - Exonic
1062346302 9:136116905-136116927 ACCTAGCGCCGCCGCCGCCGGGG - Exonic
1062537751 9:137028294-137028316 GGGCAGAGTCGCTGTCGCCGCGG - Intronic
1202779846 9_KI270717v1_random:24374-24396 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1203467937 Un_GL000220v1:104748-104770 GGGCAGCCCCACGCCCGCCGCGG - Intergenic
1203469641 Un_GL000220v1:110968-110990 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203469880 Un_GL000220v1:111682-111704 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1203471325 Un_GL000220v1:116519-116541 GGACCGTGCCCCCGCCGCCGGGG - Intergenic
1203471371 Un_GL000220v1:116635-116657 GGGCGTCGCGGCCGCCCCCGGGG + Intergenic
1203475758 Un_GL000220v1:148720-148742 GGGCAGCCCCACGCCCGCCGCGG - Intergenic
1203477462 Un_GL000220v1:154940-154962 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203477701 Un_GL000220v1:155654-155676 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1203479146 Un_GL000220v1:160491-160513 GGACCGTGCCCCCGCCGCCGGGG - Intergenic
1203479192 Un_GL000220v1:160607-160629 GGGCGTCGCGGCCGCCCCCGGGG + Intergenic
1203665423 Un_KI270754v1:18151-18173 GGACACAGCCGCCGCCGCGGCGG - Intergenic
1185457757 X:319237-319259 CGCCGCCGCCGCCGCCGCCGAGG - Intergenic
1187226076 X:17376086-17376108 GGCCGCCGCCGCCGCCGCCGAGG - Exonic
1189335732 X:40169819-40169841 GTGCAGCGCCGTCCCCGCCCTGG - Intronic
1190300338 X:49053660-49053682 GGGGAGCGCCGGCCCGGCCGCGG - Intronic
1192709339 X:73563484-73563506 AGGAAGCGCCGCCCCCGCCTCGG + Exonic
1192925002 X:75747086-75747108 CGCCACCGCCGCCGCCGCCGCGG + Intergenic
1194977593 X:100409720-100409742 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1196918254 X:120561151-120561173 GGGAAGCGCTGCAGCCGCCCGGG + Intronic
1198263846 X:134991142-134991164 AGACAGGGCCGCCGCCGCCATGG - Exonic
1198807225 X:140504334-140504356 GGCCGCCGCCGCCGCTGCCGCGG - Exonic
1200292504 X:154886395-154886417 GGCCGGCGCCGCCGCCGCCCAGG - Exonic
1200339348 X:155382135-155382157 GGCCGGCGCCGCCGCCGCCCAGG - Exonic
1200347122 X:155458558-155458580 GGCCGGCGCCGCCGCCGCCCAGG + Exonic