ID: 1132366913

View in Genome Browser
Species Human (GRCh38)
Location 15:101264475-101264497
Sequence CTGTTTCTGCAGGAGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132366913_1132366916 -10 Left 1132366913 15:101264475-101264497 CCTGCTTCCTCCTGCAGAAACAG No data
Right 1132366916 15:101264488-101264510 GCAGAAACAGCTTTCACTTAAGG No data
1132366913_1132366917 -4 Left 1132366913 15:101264475-101264497 CCTGCTTCCTCCTGCAGAAACAG No data
Right 1132366917 15:101264494-101264516 ACAGCTTTCACTTAAGGTACTGG No data
1132366913_1132366918 -3 Left 1132366913 15:101264475-101264497 CCTGCTTCCTCCTGCAGAAACAG No data
Right 1132366918 15:101264495-101264517 CAGCTTTCACTTAAGGTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132366913 Original CRISPR CTGTTTCTGCAGGAGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr