ID: 1132369055

View in Genome Browser
Species Human (GRCh38)
Location 15:101280565-101280587
Sequence CCACGCCTGGCCAAACTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132369055_1132369064 11 Left 1132369055 15:101280565-101280587 CCCCTGAGTTTGGCCAGGCGTGG No data
Right 1132369064 15:101280599-101280621 TGTAATCCCAGCACTTTGGGCGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
1132369055_1132369069 21 Left 1132369055 15:101280565-101280587 CCCCTGAGTTTGGCCAGGCGTGG No data
Right 1132369069 15:101280609-101280631 GCACTTTGGGCGGCCGAGGCGGG 0: 124
1: 85497
2: 221087
3: 235405
4: 157881
1132369055_1132369061 7 Left 1132369055 15:101280565-101280587 CCCCTGAGTTTGGCCAGGCGTGG No data
Right 1132369061 15:101280595-101280617 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
1132369055_1132369066 17 Left 1132369055 15:101280565-101280587 CCCCTGAGTTTGGCCAGGCGTGG No data
Right 1132369066 15:101280605-101280627 CCCAGCACTTTGGGCGGCCGAGG 0: 190
1: 116028
2: 262250
3: 214916
4: 129530
1132369055_1132369070 24 Left 1132369055 15:101280565-101280587 CCCCTGAGTTTGGCCAGGCGTGG No data
Right 1132369070 15:101280612-101280634 CTTTGGGCGGCCGAGGCGGGAGG 0: 59
1: 39630
2: 121314
3: 192402
4: 147752
1132369055_1132369068 20 Left 1132369055 15:101280565-101280587 CCCCTGAGTTTGGCCAGGCGTGG No data
Right 1132369068 15:101280608-101280630 AGCACTTTGGGCGGCCGAGGCGG 0: 123
1: 89246
2: 184671
3: 139091
4: 74063
1132369055_1132369062 8 Left 1132369055 15:101280565-101280587 CCCCTGAGTTTGGCCAGGCGTGG No data
Right 1132369062 15:101280596-101280618 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132369055 Original CRISPR CCACGCCTGGCCAAACTCAG GGG (reversed) Intergenic
No off target data available for this crispr