ID: 1132371767

View in Genome Browser
Species Human (GRCh38)
Location 15:101304546-101304568
Sequence CTGAAGACACAGACAGAACA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 726
Summary {0: 1, 1: 0, 2: 6, 3: 74, 4: 645}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132371761_1132371767 28 Left 1132371761 15:101304495-101304517 CCTCAGAAGGCTCTGCATCAGGT 0: 1
1: 0
2: 2
3: 20
4: 190
Right 1132371767 15:101304546-101304568 CTGAAGACACAGACAGAACACGG 0: 1
1: 0
2: 6
3: 74
4: 645

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132371767 Original CRISPR CTGAAGACACAGACAGAACA CGG Exonic
902064308 1:13671536-13671558 CTGAAGATGCAGCTAGAACAAGG + Intergenic
902079249 1:13809949-13809971 GTGAGGACACAGACAGAAGGTGG - Intronic
903913022 1:26742418-26742440 AAGAAGACAGACACAGAACAGGG - Intronic
904821921 1:33251103-33251125 CTGAAGGGACAGAAAGAACAGGG + Intergenic
904824971 1:33268464-33268486 ATGAGCAAACAGACAGAACATGG + Intronic
905115537 1:35636105-35636127 GTGAAGACACAGGGAGAAGATGG + Intronic
905554973 1:38874959-38874981 CTGAAGGCAAAGACAGCAAAAGG - Exonic
905620528 1:39441827-39441849 CTGAAATCACAAACAGCACAAGG + Intronic
905695415 1:39969961-39969983 CTGAGGACACAGACAGAAACAGG - Exonic
906033330 1:42736604-42736626 CTGAAGGCAGAGAAGGAACAGGG - Intronic
906301718 1:44687206-44687228 GTGAAGACACAGGGAAAACATGG - Intronic
906674082 1:47680756-47680778 CTGAAGACACAGGGAGAAGACGG - Intergenic
907026992 1:51129749-51129771 CTGAAAACACAGCAAGAAAAAGG - Intronic
907250427 1:53134430-53134452 CTGAAAACACAGTAAGAACTGGG + Intronic
907903671 1:58764765-58764787 CTCAACACACTGACAGGACAAGG - Intergenic
908053879 1:60261847-60261869 GTGAAGACACAGCAAGAAGATGG - Intergenic
908089986 1:60675886-60675908 GTGAAGACACAGACCAAAAAAGG - Intergenic
908961862 1:69707821-69707843 ATAAAGACCCAGACAGACCAAGG + Intronic
909134828 1:71784944-71784966 TTGAAGACAAAAACACAACATGG + Intronic
909619885 1:77655442-77655464 GTGAAGACACAGTGAGAAGATGG + Intronic
910132205 1:83921593-83921615 CTGAAGATACAGAGACAAAATGG + Intronic
910251031 1:85200273-85200295 CTGGAGGCACCGACAGGACACGG + Exonic
910286276 1:85557826-85557848 CTGAAGACACAAACAGAAGGTGG + Intronic
911127267 1:94352207-94352229 CTGGGGACACATACATAACAAGG - Intergenic
911697146 1:100902635-100902657 CTGAAGCTACAGAAAGATCATGG - Intronic
911736671 1:101343861-101343883 GTGAAGACACGGAGAGAAGATGG + Intergenic
912230132 1:107783569-107783591 TAGAAGACACAGAGAGAACAAGG - Intronic
913996599 1:143655909-143655931 CTGAAGACACAGTGGGAAGACGG - Intergenic
915047358 1:153029559-153029581 CTGCTGACAAAGACATAACAGGG + Intergenic
915926127 1:160020969-160020991 GTGAAGACAAAAACAGAAGATGG + Intergenic
916165561 1:161964309-161964331 CTGAAGACATAGATAAAATATGG - Intergenic
916206144 1:162318101-162318123 CTCAAGACAGAGACAGCAGAAGG - Intronic
916336322 1:163674727-163674749 CTTAAGACACGAACAGAGCAGGG - Intergenic
916741561 1:167651011-167651033 GTGAAGACACAGGGAGAAGATGG - Intronic
917527466 1:175801769-175801791 GTGAAGACACAGGGAGGACACGG - Intergenic
917689372 1:177451604-177451626 CTGAAGAGACTGACAGATCAAGG + Intergenic
918448677 1:184639011-184639033 GTGAAGACACAGTGAGAAGATGG + Intergenic
918552147 1:185755689-185755711 CTGAAGACTGTGACAGACCAGGG + Intronic
918734897 1:188048235-188048257 TTGAAGAGAGAGACACAACAGGG - Intergenic
918923308 1:190744768-190744790 GTGAAGACACAGGGAGAAGATGG - Intergenic
919590022 1:199490157-199490179 GTGAAGACACAGCGAGAAGATGG - Intergenic
920317432 1:205087776-205087798 CTGAAAACACAGTAAGAAAAAGG + Exonic
920591909 1:207228309-207228331 CTGAAACCAGAGACAGAAAATGG + Intergenic
921968576 1:221119898-221119920 CTGAAGACACAGGGAGAAGATGG + Intergenic
922124732 1:222711748-222711770 AGGAAGACACACACAGAGCAAGG + Intronic
922453089 1:225752295-225752317 TTAAAAACAGAGACAGAACAGGG - Intergenic
922728929 1:227940118-227940140 CTGCAGACACAGACAGGGCAGGG - Intronic
922863853 1:228842211-228842233 CTGAAGACAGTGACAGAGAAAGG + Intergenic
923002022 1:230014459-230014481 CAAAAAACACACACAGAACAAGG - Intergenic
923006221 1:230052186-230052208 GTGAGGACACAGAGAGAAGATGG + Intergenic
923064199 1:230503268-230503290 GTGAAGACACAGGGAGAAGACGG + Intergenic
923200351 1:231705036-231705058 CTTAAAATACAGACAGACCAAGG + Intronic
923366497 1:233266945-233266967 CTGAAGAAACAGACAGAGGTGGG - Intronic
923436291 1:233970726-233970748 ATGAAGAGACAGAGAGAAGACGG + Intronic
924015772 1:239720112-239720134 GTAAAGACACAGATACAACACGG - Intronic
924047540 1:240047285-240047307 GTGAAGACACAGTGAGAAGATGG + Intronic
924143377 1:241049008-241049030 ATGAAGACACAGACAGAAGAGGG - Intronic
924444066 1:244112295-244112317 CTGAAGCCACAGTGAGAAAACGG + Intergenic
924808026 1:247377151-247377173 TGAAAGACACAGACAGGACAAGG - Intergenic
1062819709 10:525640-525662 CTGAGGACAGGGAGAGAACAGGG + Intronic
1062989779 10:1804570-1804592 CTGTAGCCACAGAAACAACAGGG + Intergenic
1063309740 10:4940991-4941013 CTGAGGCTACAGAGAGAACAGGG + Intronic
1064574904 10:16734949-16734971 GTGAAGACACAGGGAGAAAAGGG + Intronic
1064980104 10:21157913-21157935 GTGAAGACACAGGGAGAAGACGG + Intronic
1065130779 10:22617833-22617855 CTCAAGACACAGATTGAAAAAGG + Intronic
1065294413 10:24260877-24260899 CTCTATTCACAGACAGAACAGGG - Intronic
1065772071 10:29086987-29087009 GTGAACACACAGAGAGAAGAAGG - Intergenic
1066442915 10:35455658-35455680 CTCAAGACCCAGAGAGAAAAGGG - Intronic
1066779182 10:38924645-38924667 ATGAAGACCCAGACACAAGATGG + Intergenic
1067278027 10:44851683-44851705 TTGAAGACACAGGGAGAAGATGG - Intergenic
1067289373 10:44930083-44930105 CTCAAAACAGAGACAAAACAGGG - Intronic
1067795423 10:49317927-49317949 GTGAAGACACAGGGAGAAGACGG + Intronic
1067824565 10:49560865-49560887 CTGAAGACCCAGAGAGTTCAGGG - Intergenic
1069682706 10:70296636-70296658 CTGGAGACACAGTCAGAGCACGG + Intergenic
1069906085 10:71733215-71733237 ATGAAGAGACACACAGAGCAAGG + Intronic
1070588775 10:77786815-77786837 CTGAAGCTCCAGAAAGAACAGGG + Intergenic
1070927555 10:80235869-80235891 CTAAAGACACAGAGAGGACTTGG - Intergenic
1071305298 10:84294130-84294152 CTGAAGTCAAAAACAGCACATGG - Intergenic
1071892088 10:90020501-90020523 CTTAAGACCCAGACAGACAAGGG + Intergenic
1072260488 10:93665863-93665885 GTGAAGACACAGGGAGAAGATGG - Exonic
1074199919 10:111225489-111225511 CTGCTGAGACAGACAGAAGAAGG - Intergenic
1074499320 10:114008728-114008750 TTGAACACAGAGACTGAACAAGG - Intergenic
1075444919 10:122506444-122506466 CTGAAGCCACACACACACCAAGG - Intronic
1075602332 10:123779139-123779161 CTGAATACATTTACAGAACAAGG - Intronic
1075678257 10:124312815-124312837 GTGAAGACACAGGGAGAAGATGG - Intergenic
1076763556 10:132617614-132617636 CTGTTGACAAAGACAGTACATGG + Intronic
1077063627 11:628134-628156 CTGAATCCACAGACAGAAAGTGG - Intergenic
1078187798 11:9066968-9066990 CTGCATACACAGACACCACAGGG - Intronic
1079072242 11:17357285-17357307 GTGAAGACACAGGGAGAAGATGG - Intronic
1079111425 11:17607318-17607340 CTGAACACACAGCCTGAACAGGG - Intronic
1079284109 11:19113940-19113962 GTGAAGACACAGGGAGAAGATGG + Intergenic
1079326555 11:19497720-19497742 CTAAAGCCACAGACAGAAAATGG + Intronic
1079540206 11:21564058-21564080 CTGAAGACAGAGCCAGGCCACGG + Intronic
1079592905 11:22202612-22202634 GTGAAGACACAGTAAGAAGATGG - Intronic
1080252140 11:30245448-30245470 GTGAAGACACAGAGAGAAGGTGG - Intergenic
1080646026 11:34188308-34188330 CTGAGGACACAGCAGGAACAGGG + Intronic
1080688265 11:34533987-34534009 GTGAAGACACAGGGAGAAGATGG + Intergenic
1080797232 11:35576049-35576071 GTGAAGACACAGCGAGAAGATGG - Intergenic
1080881131 11:36321849-36321871 GTGAAGACACAGGGAGAAGATGG - Intronic
1081164747 11:39793788-39793810 GTGAAGACACAAAGAGAAGAAGG + Intergenic
1081183026 11:40007248-40007270 ATGAAGAGACAGAGAGAAGATGG - Intergenic
1081653984 11:44845141-44845163 CTGAAGACTCACCCAGAGCAGGG + Intronic
1082011305 11:47451310-47451332 GTGAAGACACAGGGAGAAGATGG + Intergenic
1082114309 11:48311575-48311597 GTGAGGACACAGAAAGAAGACGG - Intergenic
1083140100 11:60714645-60714667 GACAAGACACAGAGAGAACAGGG - Intronic
1083557589 11:63643893-63643915 CTAAAGACACATATAGAACTTGG + Intronic
1083752760 11:64770206-64770228 ATGAAGACACATGCAGATCATGG - Intronic
1084010085 11:66342988-66343010 CTGAAGACACAGAAAAGAGAGGG - Intronic
1084034419 11:66499952-66499974 CTGAAGCCATGGACAGTACAGGG - Intronic
1084110976 11:67014022-67014044 ATGAAGGCACAGAGAGAAGAAGG - Intronic
1084515527 11:69636372-69636394 CTGAAGAAAGTGACAGAACCGGG - Intergenic
1084521879 11:69668312-69668334 ATGCAGAAACAGACAGAACTGGG + Intronic
1084565480 11:69926167-69926189 ATGAAGACACAGAATGAACTGGG + Intergenic
1084747502 11:71182551-71182573 GTGAAGACACAGGGAGAAGATGG - Intronic
1085432353 11:76463716-76463738 CTTAAGACAGAGAGAGGACAAGG + Intronic
1086895361 11:92305775-92305797 CGGAAGACAAAGACAGACTAAGG + Intergenic
1088130924 11:106489805-106489827 GTGAAGACACAGTGAGAAGAAGG - Intergenic
1088569169 11:111204478-111204500 GTGAGGACACAAACAGAAGATGG + Intergenic
1088864184 11:113831138-113831160 CTGAAGACACAAAGACAAGAAGG + Intronic
1089767862 11:120781645-120781667 GTGAAGACACAGACAGGGCAGGG - Intronic
1090270524 11:125382801-125382823 CTGAAGACAAAGAGAAAACCAGG - Intronic
1090488377 11:127135484-127135506 CTGCATACACAGACACCACAGGG + Intergenic
1091159176 11:133404153-133404175 GTGAAGACACAGCCAATACAGGG - Intronic
1091269400 11:134295581-134295603 TTGAAGACACAAAAATAACAGGG - Intronic
1091311004 11:134575140-134575162 CTGAGGACACAGCGAGAAGACGG + Intergenic
1092058912 12:5532115-5532137 CTGAAGAAACAGCCAGCCCATGG + Intronic
1092659408 12:10722729-10722751 CTGGAGACGCTGACAGCACAGGG - Intronic
1093564431 12:20585816-20585838 GTGAAGACACAGAAAGGAAAAGG - Intronic
1094101665 12:26770983-26771005 ATAAAGACACAGTCAGAAAATGG - Intronic
1094320632 12:29179010-29179032 CTGAAGACACAGGAAAAAGATGG - Intronic
1094527826 12:31244312-31244334 CTGAAGGCAAAGAAAGAACTAGG + Intergenic
1094566006 12:31598992-31599014 GTGAAGACAGAGACAGAGCTTGG + Intergenic
1094674560 12:32606569-32606591 CTGAAGAAAAAGACAGACTAGGG - Intronic
1095392546 12:41726283-41726305 CTGAAGACAAAGAGAAAACATGG - Intergenic
1095434994 12:42177427-42177449 GTGAGGACACAGTGAGAACATGG - Intronic
1095535273 12:43238557-43238579 CTGAATACACAAACAGATAATGG - Intergenic
1097738928 12:63215524-63215546 GTGAGGACACAGCAAGAACACGG + Intergenic
1098579901 12:72087386-72087408 CTGAAGACACAGAAGAAAGATGG + Intronic
1098750317 12:74284705-74284727 GTGAGGACACAGCCAGAAGATGG + Intergenic
1098992569 12:77080117-77080139 CTGAATATACAGACAAAAAAAGG - Intergenic
1099389575 12:82062839-82062861 GTGAAGACACAGAAAAAAGATGG + Intergenic
1099696176 12:86022420-86022442 CACCAGGCACAGACAGAACATGG - Intronic
1099751750 12:86782794-86782816 GTGAAGACACAGTCAGAAATTGG + Intronic
1099754919 12:86833515-86833537 GTGAAGACACAGGGAGAAGACGG - Intronic
1099947213 12:89258367-89258389 ATGAAGACACAGGAAGAAAATGG + Intergenic
1100502575 12:95188266-95188288 CTGAAGGCACAGAAAAAAAATGG + Intronic
1100709760 12:97243217-97243239 TTGAAGACACCAACAGAGCAAGG - Intergenic
1100755081 12:97742462-97742484 TGGAAGGCACAGACAGAAAATGG + Intergenic
1101071491 12:101080591-101080613 CTGAAGACACAGGGAGAAGATGG - Intronic
1101071633 12:101081812-101081834 GTGAAGACACAGGGAGAAGATGG - Intronic
1101444804 12:104730070-104730092 CTGAAAACAGAGACAGTACTGGG + Intronic
1102634488 12:114311304-114311326 CTGAAAAGACAAACAGGACATGG + Intergenic
1102806039 12:115781932-115781954 CTGAAGATTCAGACATAAGAGGG - Intergenic
1103205971 12:119129182-119129204 TTGAAGACATAGACAGGGCAAGG - Intronic
1103978818 12:124722399-124722421 GTAAAGACACAGAGAGAAGATGG - Intergenic
1104404272 12:128504599-128504621 GTGAAGACACAGAGAGAAAGTGG - Intronic
1104947688 12:132423919-132423941 CTGGATCCACAGAGAGAACATGG + Intergenic
1106079128 13:26486016-26486038 CAGAAGGAACAGAGAGAACAGGG + Intergenic
1106625788 13:31419510-31419532 GAGAAGACACAGGCAGAAGACGG + Intergenic
1106692083 13:32129039-32129061 ATGAAGACACAGGGAGAAAATGG - Intronic
1106888713 13:34218990-34219012 CTTGAGACACAGACAGAAAATGG + Intergenic
1107052222 13:36063335-36063357 CTGAAGAGCCAGAGAGAACGTGG + Intronic
1107094341 13:36518598-36518620 TTGAAGACACAGTGAGAAGATGG - Intergenic
1107266703 13:38564142-38564164 GTGAAGAGGCAGAGAGAACACGG - Intergenic
1107830057 13:44367128-44367150 CTGAAGTGGCAGACAGGACATGG - Intergenic
1107958907 13:45542154-45542176 CTGCAGACCCAGGCAGAACTTGG - Intronic
1108711713 13:53039632-53039654 CTTAAGACTCTGACAGAAAATGG - Intronic
1109460309 13:62647225-62647247 CTGAAGGCAAAGGCAAAACAGGG + Intergenic
1110181067 13:72617362-72617384 CTGATGACAAACATAGAACAGGG + Intergenic
1111931880 13:94521061-94521083 ATGAAGACACAGGCAGACCTGGG + Intergenic
1112169184 13:96951939-96951961 CTGAAGATATATAAAGAACATGG + Intergenic
1112212182 13:97388720-97388742 CTGGAGATATAGACAGAACAGGG - Intronic
1112630151 13:101152129-101152151 CTGAAGCCACAGATAGAAATTGG + Intronic
1112955298 13:105050724-105050746 CAGAAGACACAGACAGCAGCTGG + Intergenic
1113017110 13:105840268-105840290 CTGAGGACACAGCCAGAGGAGGG + Intergenic
1113148904 13:107240213-107240235 ATGAGGACACAGAGAGAAGATGG + Intronic
1114363568 14:22002878-22002900 CTGCAGACTCAGAAAGAAAACGG - Intergenic
1114570757 14:23666062-23666084 GTGAGGACACAGCCAGAAGATGG + Intergenic
1114888323 14:26883258-26883280 GTGAAGACACAGGGAGAAGATGG + Intergenic
1115088228 14:29542820-29542842 CTATACACACAAACAGAACAAGG + Intergenic
1115112748 14:29843221-29843243 GTGAAGATACAGAGAGAAGATGG + Intronic
1115306536 14:31939308-31939330 GAGAAGACACAGACAGAAGATGG + Intergenic
1115572670 14:34681470-34681492 CTGAAGACCCAGAGAAACCAGGG - Intergenic
1115592735 14:34879754-34879776 CTAAAGACACTGACTGGACAAGG - Intergenic
1115723984 14:36193388-36193410 CTGGAGACACCAACAGAACATGG - Intergenic
1116082301 14:40190168-40190190 GTGAAGACACAGGGAGAAAATGG - Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116213673 14:41981682-41981704 CTGAAGACACAGATAGGTCATGG - Intergenic
1116505857 14:45680419-45680441 CTGGAGAAAAAGACAGAAAAAGG + Intergenic
1116975900 14:51115713-51115735 GTGAAGACACAGGGAGAAGATGG - Intergenic
1117048344 14:51835580-51835602 TTGCAGAGACACACAGAACATGG - Intronic
1117810821 14:59544862-59544884 GTGAAGACACAGAGAGAAAGCGG + Intronic
1118032105 14:61828095-61828117 GTGAAGACACAGGAAGAAGATGG + Intergenic
1118071368 14:62249878-62249900 ATGAAGTCACAGAGAGAAGATGG - Intergenic
1120339238 14:83197824-83197846 CTGAAGACAGAGACAGGATCAGG + Intergenic
1120397014 14:83980812-83980834 CTGGAGAGACAGACAAAATAAGG - Intergenic
1121010809 14:90519048-90519070 CAGAAGACACAGAAGGCACAGGG - Intergenic
1121223297 14:92302578-92302600 CTGACGAACCAGACAGAGCAGGG + Intergenic
1121240316 14:92425138-92425160 GTGAAGACACAGGCAGAAGGTGG + Intronic
1121467378 14:94124674-94124696 CAGAAGCCACAGAGACAACATGG - Intergenic
1121802732 14:96788412-96788434 CTGAAGACACAAGGAGAAGACGG - Intergenic
1121901855 14:97700059-97700081 CAGAAGACACACAGAAAACACGG - Intergenic
1122166349 14:99827253-99827275 CTGAAGACACAGGGAGAAGATGG + Intronic
1122361693 14:101171061-101171083 GTGAAGACACAGAGAGAAGATGG - Intergenic
1122375527 14:101254499-101254521 GTGAGGACACAGAGAGAAGACGG - Intergenic
1122810671 14:104286256-104286278 GTGAGGACACAGCCAGAAGACGG - Intergenic
1124212584 15:27775757-27775779 GTGAAGACACAGGGAGAAGACGG - Intronic
1124965753 15:34432370-34432392 CAGGAGACAGGGACAGAACACGG + Intronic
1125347591 15:38733704-38733726 ATGAAGACACAGTGAGAAGATGG - Intergenic
1126957522 15:53950720-53950742 CTGAAGACACAGAAATAGCCAGG + Intergenic
1127327834 15:57912709-57912731 TTGGAAACACAGACAGAACCTGG - Intergenic
1127341488 15:58049534-58049556 ACGAATACTCAGACAGAACAAGG - Intronic
1128502954 15:68241594-68241616 CTGAGGACACTGAGAGACCAAGG + Intronic
1128583971 15:68831340-68831362 CTTAGGTCAAAGACAGAACATGG - Intronic
1130555490 15:84919609-84919631 CACAAGACACAGAGAGATCAGGG + Intronic
1131241860 15:90751725-90751747 CTAATGAGACAGAAAGAACAGGG - Intronic
1131893263 15:96997508-96997530 ATGAAGGCAGAGACAGAAAAGGG - Intergenic
1131994688 15:98122754-98122776 ATGAAGACTCAGAGAGAAGATGG - Intergenic
1132371767 15:101304546-101304568 CTGAAGACACAGACAGAACACGG + Exonic
1133251700 16:4486516-4486538 TTGAAGACACAGAAACTACATGG + Intronic
1133418666 16:5626314-5626336 ATGAAGACACAGGGAGAAGACGG - Intergenic
1133978651 16:10617965-10617987 CTGATGACCCAGACAGGACAGGG - Intergenic
1134060195 16:11194918-11194940 CAGAAGCCACAGCAAGAACAGGG + Intergenic
1134400282 16:13903641-13903663 ATGAAGACACAGGGAGAACACGG + Intergenic
1135462307 16:22655393-22655415 GTGAAGACACAGGGAGAAGATGG + Intergenic
1138334200 16:56239833-56239855 CTAAAGATAGAGACAGCACATGG + Intronic
1139146651 16:64332707-64332729 CTGAAGACACAGAAATGAAAAGG + Intergenic
1139334534 16:66222598-66222620 GTGAAAACACAGACACAAGATGG + Intergenic
1141121162 16:81358107-81358129 CTGAAGATACAGAGATAATAAGG - Intronic
1141225532 16:82111252-82111274 CTTAAAACAAAAACAGAACATGG - Intergenic
1141954389 16:87360788-87360810 TTGAACACACAGGCAGCACAGGG - Intronic
1142257454 16:89021329-89021351 CTGAAGACGCAAAAAGAATAAGG + Intergenic
1142361304 16:89628685-89628707 CTGAAGCGACAAGCAGAACATGG + Intronic
1142390647 16:89797432-89797454 CTCAAGACACTCACACAACAGGG + Intronic
1143403666 17:6661672-6661694 CTGAAGAAACAGACACAAGTGGG - Intergenic
1143771949 17:9174574-9174596 GTGAAGACACAGGGAGAAGACGG - Intronic
1144193492 17:12868195-12868217 ATGAAGACGCAGAGAGAAGATGG - Intronic
1144263108 17:13542453-13542475 GTGAAGACACAGAGAGAAGGTGG + Intronic
1145353084 17:22105998-22106020 CGGAAGATGCAGACAGAAGAGGG - Intergenic
1145904271 17:28507784-28507806 CACAAGACACAGGCAGTACAAGG + Intronic
1146685100 17:34836254-34836276 CTAACAACTCAGACAGAACAAGG - Intergenic
1146916257 17:36680261-36680283 GAGAAGACAGAGACAGAGCAGGG + Intergenic
1147406339 17:40215082-40215104 ATGAAGAAACAGACACAGCAAGG - Intergenic
1147970459 17:44216825-44216847 CTGAAGGCACAGACAAGATATGG + Intronic
1148254857 17:46121331-46121353 GTGAAGTCATAGACAGAAAAGGG - Intronic
1149144356 17:53472177-53472199 GTGAAGACACAGCAAGAAGATGG - Intergenic
1149248326 17:54738158-54738180 CTAAAGACGGAGACAGAAAATGG + Intergenic
1149442751 17:56688952-56688974 GTGAAGTTACAGAAAGAACAAGG + Intergenic
1150422791 17:65054170-65054192 CCGAAGCAACAAACAGAACATGG - Intronic
1151064749 17:71136575-71136597 CTGAAAATACAGACAATACAGGG - Intergenic
1151355294 17:73554489-73554511 GTGAAGACACAGGGAGAAGATGG + Intronic
1151393886 17:73806991-73807013 ATGAAGACACAGCTAGAAGATGG - Intergenic
1151906920 17:77054800-77054822 GTGAACACACAGACAGAGCCTGG + Intergenic
1152223871 17:79083738-79083760 CTGAAGAAAAGGGCAGAACAGGG - Intronic
1152283725 17:79400379-79400401 GTGAAGACACATACAGGAAAAGG - Intronic
1152559105 17:81068991-81069013 CCGTAGAAACAGACAGGACAGGG + Intronic
1152581623 17:81167885-81167907 CTGAAGACACAGACTGAACGAGG - Intergenic
1153028226 18:690082-690104 CTGAAGAGACACACAGGGCAAGG - Intronic
1153296382 18:3550640-3550662 ATGAAGACACAGGGAGAAGATGG + Intronic
1153298117 18:3567549-3567571 CTGAAGAACCTGACAAAACAGGG - Exonic
1153512804 18:5873834-5873856 ATGAAGACACAGGGAGAAGATGG + Intergenic
1154175933 18:12087303-12087325 GTGATGACACAGCCAGAGCACGG - Intergenic
1154176404 18:12089009-12089031 GTGATGACACAGCCAGAGCACGG - Intergenic
1154415500 18:14173526-14173548 GTGATGACACAGCCAGAGCACGG + Intergenic
1154489465 18:14908647-14908669 CTAAAGACACAGACACTAAAAGG - Intergenic
1155222464 18:23697930-23697952 GTGAAGACACAGGCAGAAGGTGG - Intronic
1156073769 18:33246776-33246798 CTAAAGACACATAGAGAGCAAGG + Intronic
1156513070 18:37657745-37657767 CTGAAAACTCACAGAGAACAGGG - Intergenic
1156521750 18:37727736-37727758 GTGCAGACACAGACAGAAGATGG - Intergenic
1156566625 18:38198608-38198630 GTGAAGACATAGAGAGAAAATGG - Intergenic
1157192306 18:45591782-45591804 ATGAAGACACATGCAGAAAAAGG + Intronic
1158039251 18:53072463-53072485 CTGCAGACACTGTCAGAAAACGG - Intronic
1158428675 18:57363390-57363412 CTTAAGACACAGACACAAGGTGG - Exonic
1158529023 18:58241465-58241487 CTGAAGGCACACATAGAACCGGG - Intronic
1158787630 18:60734895-60734917 GTGAAGACACAGAAAGAAGATGG - Intergenic
1158808396 18:61002596-61002618 CTGAGGACACAGCAAGAAGAAGG + Intergenic
1159202964 18:65211405-65211427 GTGAAGACACAGTAAGAAGATGG + Intergenic
1159469827 18:68837618-68837640 GTGAAGACACAGGGAGAAAACGG - Intronic
1159579427 18:70218612-70218634 CTGAGGACACAGAGAGAAGATGG - Intergenic
1159820267 18:73132232-73132254 CTGAAGACACAGGGAGAAGATGG + Intergenic
1159879409 18:73844562-73844584 GTGAGGACACAGAGAGAAGATGG - Intergenic
1160246194 18:77162144-77162166 GTGAAGACACAGACTCCACAGGG + Intergenic
1161060209 19:2210970-2210992 CTGAAGGCACAGCCACAACAGGG - Intronic
1161540293 19:4846752-4846774 GTGAATACACAGAGAGAAGATGG + Intronic
1161652459 19:5493589-5493611 CCGAGGACTCAGACAGAAGAGGG - Intergenic
1162299108 19:9834383-9834405 TTGAAGACACTGACAGCAAAGGG - Intergenic
1163134466 19:15299617-15299639 GTAGAGACACACACAGAACAGGG + Intronic
1163518532 19:17778972-17778994 CTGGAGACACAGCCAGGACCAGG + Intronic
1163627978 19:18401859-18401881 CTGAGGACACAGTGAGAAGACGG - Intergenic
1164014039 19:21236159-21236181 CTGGACACACAGATAGAAAAGGG + Intronic
1165234370 19:34408700-34408722 GTGTAGACACAGACAGAACAAGG - Intronic
1165344512 19:35236121-35236143 CTGAAGACCCAGACAAAATCAGG + Intergenic
1165464268 19:35963366-35963388 CTGTGGACACAGACAGACCTGGG - Intergenic
1166032396 19:40142088-40142110 CCAAAGACACAGACAGAAATAGG + Intergenic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1166458046 19:42960715-42960737 CTGATGACACAGACAGACTTTGG + Intronic
1166715193 19:44962505-44962527 ATGAAGACACAGGGAGAAGACGG - Intronic
1166883352 19:45942358-45942380 GTGAAGACACAGGGAGAAGAAGG + Intronic
1168241651 19:55091913-55091935 GTGAGGACACAGAAAGCACAGGG + Intronic
1168456663 19:56516791-56516813 CTGAAGACACAAACTGAAAATGG + Intronic
1168460042 19:56547209-56547231 GTGAGGACACAGAGAGAAGACGG - Intronic
1168576525 19:57516177-57516199 CTGAATGCAAAGACAGAACAAGG + Intronic
1168680540 19:58312289-58312311 CTGAATGCAAAGACAGAACAAGG + Exonic
925316190 2:2926074-2926096 GTGAAGACACAGGAAGAAGATGG + Intergenic
925714544 2:6772382-6772404 CTGAACACAGAGACAGAGGAAGG - Intergenic
925868191 2:8247108-8247130 CAGAACAGGCAGACAGAACACGG + Intergenic
926705028 2:15831038-15831060 ATGAAGAGACAGACAGAAGGTGG + Intergenic
926843790 2:17111030-17111052 GTGAAGGCACAGCCAAAACATGG - Intergenic
928116145 2:28546349-28546371 CCGAAGCCACAGGCAGAATAAGG + Intronic
928327702 2:30333256-30333278 CTGAACGCACAGCCAGAGCAGGG - Intergenic
929047778 2:37806759-37806781 GTGAAGACACAGGGAGAAGATGG + Intergenic
929247053 2:39713568-39713590 GTGAAGACACAGGGAGAAGATGG + Intronic
931995736 2:67837635-67837657 GTGAAGGCACAGAGAGAACCAGG - Intergenic
932619324 2:73256567-73256589 CTTCACACACAGCCAGAACAGGG + Exonic
933188257 2:79303129-79303151 TTGAAAACAGAGACAAAACAAGG + Intronic
933364959 2:81340884-81340906 ATGAAGACACAGTCAGAAGGTGG - Intergenic
933755572 2:85635653-85635675 CTGAAAAGGCATACAGAACAAGG - Intronic
934879159 2:97958401-97958423 CTGAAGACAGAGAAAGCCCATGG + Intronic
935529847 2:104218969-104218991 GTGAAGACACAGGGAGAAGATGG - Intergenic
935531284 2:104235179-104235201 ATGAAGACACACAAAGAAGAAGG + Intergenic
935643634 2:105314110-105314132 GTGAAGACACAGAAAGAGGAAGG + Intronic
935927328 2:108083718-108083740 CTCCAGACCCAGAGAGAACATGG + Intergenic
936002817 2:108851155-108851177 ATGAAGAGAGAGACAGAGCAAGG + Intronic
936140536 2:109936235-109936257 GTGAAGACACAGAGAGGAGATGG + Intergenic
936177227 2:110234180-110234202 GTGAAGACACAGAGAGGAGATGG + Intergenic
936204158 2:110435251-110435273 GTGAAGACACAGAGAGGAGATGG - Exonic
936260665 2:110957572-110957594 GTGAAGACACAGGCAGGAGATGG - Intronic
936396503 2:112135878-112135900 CTGAGGACAAAGACAGAGAAAGG + Intergenic
936616734 2:114055740-114055762 CTGAGGACACAGGGAGAAGATGG + Intergenic
936892905 2:117392965-117392987 GTGAAGACACAGAGAGAAGGTGG - Intergenic
937017737 2:118620987-118621009 ATGAAGGCACAGCCAGAAAAAGG - Intergenic
937071946 2:119070755-119070777 CAGAAGACAAAGAGAGAAAAGGG - Intergenic
937086657 2:119176307-119176329 GTGAAGACACAGGGAGAAGAGGG - Intergenic
937090698 2:119204539-119204561 CTGGAGAGACAGGGAGAACAGGG + Intergenic
937502994 2:122503512-122503534 AGGAAGACAATGACAGAACAAGG - Intergenic
937671377 2:124541103-124541125 CAGAGGACACACACAGAACATGG - Intronic
937795368 2:126011654-126011676 GTGAAGACACAGTAAGAAGATGG + Intergenic
937921075 2:127131316-127131338 GTGAAGGCACAGAGAGAAAACGG + Intergenic
937976815 2:127587487-127587509 ATGAGGACACAGAGAGAAGACGG - Intronic
938920857 2:135993318-135993340 GTGAAGACACAGGGAGAAGAGGG + Intergenic
939173960 2:138728229-138728251 ATGAAGACACAGGGAGAAGATGG + Intronic
939684965 2:145188096-145188118 GTGAAGACACAGAGAGAAGATGG - Intergenic
940559619 2:155279117-155279139 CTCAAGACATAAACAGTACAAGG - Intergenic
940653210 2:156457990-156458012 CAGAAGACACAGACAGCCCTGGG - Intronic
940805134 2:158178903-158178925 ATGAAGACAAAGAGAGAGCACGG - Exonic
941628034 2:167851481-167851503 CTCAAGACGGAGACATAACATGG - Intergenic
941942145 2:171051758-171051780 GTAGAGACACAAACAGAACAAGG + Intronic
942747504 2:179251783-179251805 ATGAAGACACAGCAAGAAGATGG + Intronic
942946923 2:181682540-181682562 CTGAAGATACAGACAGTACAGGG - Intergenic
943032895 2:182706611-182706633 ATGAAAACAAAGAAAGAACATGG - Intergenic
943349045 2:186775732-186775754 CTAAAGACACAGAAATAAAAAGG + Intergenic
943465696 2:188226636-188226658 GTGAAGACACAGAATGAAAATGG + Intergenic
943762464 2:191624796-191624818 GTGAAGACACAGAAAGAAGATGG - Intergenic
944832421 2:203546184-203546206 GTGAAGACACAGGGAGAAGACGG - Intergenic
944876707 2:203969511-203969533 ATGAAGAAAAAGACATAACAAGG - Intergenic
945711054 2:213294803-213294825 CAGAAAACCCACACAGAACATGG + Intronic
946026098 2:216672912-216672934 TTAAAAACACAGACAGTACAAGG + Exonic
946345554 2:219107638-219107660 CTGAAGACAGAGAGAGAAGTGGG - Intronic
947181428 2:227414820-227414842 GTGAAGACACAGGGAGAAGATGG + Intergenic
947837714 2:233187728-233187750 CTGAAGACAGCCCCAGAACAGGG - Intronic
947860134 2:233352769-233352791 GTGAAGACACAGGGAGAAGATGG - Intergenic
947929658 2:233953041-233953063 CTGCAGGCAAAGACAAAACATGG - Intronic
948150156 2:235738461-235738483 CTGGGGCCACACACAGAACAGGG + Intronic
948166503 2:235866778-235866800 GTGAAGACACAGGGAGAAGATGG - Intronic
1168930431 20:1619078-1619100 TTTAAGACACAGAGAGAAAATGG + Intronic
1169113561 20:3048048-3048070 CTGTACACACCGGCAGAACAGGG - Exonic
1170404462 20:16021544-16021566 GGGAAGACACAGACAGTACAAGG - Intronic
1170481327 20:16767941-16767963 CTTAAGACAGAGAAAGAACCTGG + Intronic
1170502765 20:16991599-16991621 CTGAAGTCACAGATTGACCATGG + Intergenic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171190275 20:23154036-23154058 GTGAGGACACAGAGAGAAGATGG - Intergenic
1171447437 20:25214595-25214617 CTGAACACACTCACAGAACATGG + Intronic
1172053837 20:32140419-32140441 CTGAAGACACAGAGATAAATAGG + Intronic
1172328635 20:34057947-34057969 CTTTGGACAGAGACAGAACAAGG - Intronic
1172883230 20:38215095-38215117 CTGGACACACAGACAGATGATGG - Intronic
1173008778 20:39161839-39161861 CTGATGCCACAGACATAAAAAGG - Intergenic
1173470754 20:43321637-43321659 GTGAAGACACAGGGAGAAGATGG - Intergenic
1173864246 20:46304149-46304171 CTGAAGTCAGAGACAGATCCTGG + Intronic
1173881276 20:46414339-46414361 GTGAAGACACAGTGAGAAGATGG - Intronic
1174533636 20:51234095-51234117 ACGAAGACACAGAGAGAAGACGG - Intergenic
1174986027 20:55452820-55452842 CTGAGGAGACAGAGAGAACTGGG + Intergenic
1175474418 20:59260783-59260805 CTGTGGCCACAGACAGAACTGGG - Intergenic
1175487028 20:59353991-59354013 CAGAAGACACACACACACCAGGG - Intergenic
1176857824 21:13985743-13985765 GTGATGACACAGCCAGAGCACGG - Intergenic
1176866766 21:14058446-14058468 GTGATGACACAGCCAGAGCACGG + Intergenic
1177735763 21:25086703-25086725 CTGAGGACACAGGAAGAAGAGGG + Intergenic
1178039043 21:28619092-28619114 ATGAAGACACAGGGAGAAGACGG + Intergenic
1178044154 21:28675530-28675552 TACAAGACAGAGACAGAACAGGG + Intergenic
1178092765 21:29181906-29181928 CTGAAGACAGAGAGATAAAAGGG + Intergenic
1179020484 21:37636147-37636169 TTGAGGACCCAGATAGAACAGGG - Intronic
1179302464 21:40124654-40124676 GTGAAGACACAGGGAGAAGAGGG + Intronic
1179340262 21:40501417-40501439 CTCAAGACACAGATTGAAAAGGG - Intronic
1179367687 21:40773401-40773423 ATGAAGACACAGGGAGAAGAAGG - Intronic
1179501353 21:41811078-41811100 CTGAAAACACAGACAGAAAGTGG + Intronic
1179721802 21:43320549-43320571 CTGAAGATACAGGGAGAAGACGG + Intergenic
1181113419 22:20615784-20615806 CAGAAGACACAGCCAGGACCTGG + Intergenic
1181455631 22:23058771-23058793 ATGAAGGCACAGGCAGAAGAGGG + Intergenic
1181737496 22:24893241-24893263 CTGAAGACACAAAGGGAGCAAGG - Intronic
1181915825 22:26279133-26279155 GTGCAGTCACAGACAGAGCATGG - Intronic
1182275891 22:29188391-29188413 GTTAAGACACAGAGAGAAGATGG - Intergenic
1182509516 22:30809001-30809023 GTGAAGACACAGACAGAGAGGGG + Intronic
1182820766 22:33214254-33214276 CTGAAGACACAGGGAGAAGATGG - Intronic
1182942043 22:34286215-34286237 CTGAAGACACAGCCAAAAGCAGG - Intergenic
1183413100 22:37666762-37666784 CTGAAAACACTGACCGCACAGGG - Exonic
1183756729 22:39774054-39774076 CTAGAGACATAGACAGAACCAGG + Intronic
1184538928 22:45106990-45107012 ATGAGGACACAGCCAGAAGACGG + Intergenic
1184900736 22:47444987-47445009 GGGAAGCCACAGACAGCACAGGG + Intergenic
1184970796 22:48018639-48018661 CACAAGCCACAGCCAGAACATGG + Intergenic
1185051669 22:48557325-48557347 GTGAGGACACAGAGAGAAGACGG + Intronic
949632798 3:5946940-5946962 CAGAAGAAAAAGACATAACACGG - Intergenic
950112077 3:10425640-10425662 TGGAAGACAGAGACAGTACATGG - Intronic
950131873 3:10552827-10552849 CTGAGGCCACAGACAGCTCAGGG + Intronic
950449397 3:13057227-13057249 CTGAAGACACAGCCAGGGGATGG + Intronic
950857233 3:16116909-16116931 AAGAAGACACAGACAGAAAGTGG - Intergenic
950945765 3:16944594-16944616 GTGAAGACACAGAGAGGAGATGG + Intronic
951476901 3:23116689-23116711 CTTATGACTCAGACAGAATATGG + Intergenic
951932645 3:27985921-27985943 ATGAAGACACAGAGAGAAGATGG + Intergenic
952215892 3:31277994-31278016 GTGAAGACACAGGGAGAAGATGG - Intergenic
952299061 3:32087831-32087853 CTGAACAGACAGATAGAAAAGGG - Intergenic
952586344 3:34897408-34897430 GTGAAGACACAGGGAGAAAATGG - Intergenic
954764247 3:52899458-52899480 TTGAAGACACAGACAGCTCAAGG + Intergenic
955138361 3:56243492-56243514 CTGAAGCCATATACAGGACAGGG + Intronic
955164969 3:56501977-56501999 GTGAAGACATAGAGAGAAGATGG - Intergenic
955575525 3:60358653-60358675 CTGATAACACAGATACAACATGG + Intronic
955854112 3:63254912-63254934 GTGAAGACACAGGGAGAAGATGG + Intronic
956142740 3:66162132-66162154 GTGAAGACACAGGGAGAAGATGG - Intronic
957171654 3:76744702-76744724 CTGAAGACACTGGGAGAAGATGG - Intronic
957185445 3:76935786-76935808 GTGAAGACACAGGCAAAATATGG - Intronic
957276835 3:78100857-78100879 CTTAAAACACAGCCAGATCATGG - Intergenic
958609252 3:96403118-96403140 CATAAAACACAGACAGAAAAGGG - Intergenic
958748208 3:98163293-98163315 CCTAAGACACAGACACAACTCGG + Intergenic
959149306 3:102589838-102589860 CTAAAGACACTGACAGAAAAAGG - Intergenic
960952695 3:123009979-123010001 CTGAAGACAAAGGCAGGAAAAGG + Intronic
961580283 3:127875243-127875265 GTGAAGACACAGGGAGAAGATGG - Intergenic
961950168 3:130741277-130741299 ATGAGGACACAGCCAGAAGATGG + Intronic
962073849 3:132059592-132059614 GTGAAGACACAGGGAGAAGATGG - Intronic
962599952 3:136984197-136984219 CTGAAGATAAAGAGAGGACAAGG + Intronic
963827804 3:149973193-149973215 CTGAAAACCAAGACAGCACATGG - Intronic
964523737 3:157594998-157595020 GTGAAAACACAGAGAGAAAATGG + Intronic
964678619 3:159312555-159312577 CTGAGTAGACAGTCAGAACATGG - Intronic
966008459 3:175047012-175047034 CTGAGGACACAGTAAGAAGATGG - Intronic
966170658 3:177076337-177076359 GTGAAGACACAGGGAGAACATGG - Intronic
966405246 3:179590785-179590807 ATGAAGACACAGACTGCACTAGG + Intronic
966673598 3:182560035-182560057 CTGAAGACACAGGGAGAAGGCGG - Intergenic
967185649 3:186942288-186942310 CTGAAGCCAAGGACAGAACAGGG - Intronic
968264426 3:197351699-197351721 CTGAAGACACACTGTGAACAAGG + Intergenic
969125725 4:4946418-4946440 GTGAAGACACAGGGAGAAGACGG + Intergenic
969180572 4:5437419-5437441 GTGAAGACAAAGGCAGATCAGGG - Intronic
969440303 4:7212983-7213005 CTGAAGACCCGGGCAGCACAAGG - Intronic
969493518 4:7513075-7513097 CTGAAGAATCAGACAGACCCAGG + Intronic
969499802 4:7545764-7545786 CTGAAGACAGAGGCAGCAGAAGG - Intronic
970076659 4:12229612-12229634 ATGAAGACACAGCCAGAAGATGG + Intergenic
970374993 4:15448041-15448063 ATGAAGACACAGTGAGAAGATGG + Intergenic
970648216 4:18147475-18147497 GTGAAGACACAGGGAGAACAGGG - Intergenic
970669008 4:18374733-18374755 GTGAGGACACAGACAGAAGATGG + Intergenic
970739098 4:19211965-19211987 TTGAAGACACAGACATATAAAGG - Intergenic
971031814 4:22646013-22646035 TTGAAGACACAGGGATAACACGG - Intergenic
971198097 4:24488456-24488478 CTTGAATCACAGACAGAACAAGG + Intergenic
971243311 4:24907953-24907975 GTGAAGACACAGACGGAAGAAGG - Intronic
971927501 4:33032109-33032131 CAGTATACACAGACATAACATGG + Intergenic
972381135 4:38521576-38521598 GGGAAGACACAGAGAGAAGATGG + Intergenic
973258182 4:48134527-48134549 ATGAAGGCACAGACAGAATAAGG + Intergenic
973839468 4:54846278-54846300 GTGAGGACACAGAAAGAAAATGG - Intergenic
974235076 4:59170348-59170370 CTGAAGAGACAGAGAGAAACAGG + Intergenic
974466059 4:62258087-62258109 CTGGAGACACAGAGAGAAAATGG - Intergenic
974796107 4:66752328-66752350 AGGAAGACACAGCAAGAACATGG - Intergenic
974922740 4:68261946-68261968 ATAAATACACAGACAGAAGAAGG - Intergenic
975953222 4:79800730-79800752 GTGAAGACACAGAAAGAAGATGG + Intergenic
977262207 4:94811318-94811340 CTGAAGGCAAAGAAAGAGCAGGG + Intronic
977284326 4:95083331-95083353 ATAAAGACACAGAAAGATCATGG + Intronic
977365575 4:96063787-96063809 ATGAAGGCACAGTGAGAACAGGG + Intergenic
977483931 4:97617630-97617652 GTGAAGAACCAGACAGAATAAGG + Intronic
977870451 4:102083976-102083998 GTGAAAACACAGGCAGATCATGG + Intergenic
978122094 4:105092000-105092022 CTGAAGACACAGCCATAATAGGG + Intergenic
978344652 4:107754501-107754523 GTGAGGACACAGGGAGAACATGG - Intergenic
978481226 4:109192915-109192937 GTGAAGACACAGAGAGAGCATGG + Intronic
978496487 4:109364998-109365020 CTGAAGAGAAAGACAAAACCTGG - Intergenic
979010232 4:115357646-115357668 CTGAAGACTCAGACAGAGATTGG + Intergenic
979059576 4:116040953-116040975 CTGACGCCAAAGAGAGAACATGG - Intergenic
979184109 4:117766520-117766542 CTGTATTCACAGACAGAAAAAGG - Intergenic
979565265 4:122147593-122147615 GTGAAGACACAGGAAGAAGATGG + Intergenic
981444434 4:144819309-144819331 GTGAAGACACAGGAAGAAGACGG - Intergenic
981856152 4:149295355-149295377 GTGAAGACACAGGGAGAAGATGG + Intergenic
982969572 4:161966629-161966651 GTGAAGACACAGAGAAAACATGG + Intronic
983197590 4:164824506-164824528 CTGAAGACACAGGAACACCAAGG - Intergenic
983606030 4:169585186-169585208 CTGAAGAAAAAGAAAGACCATGG + Intronic
983960169 4:173742831-173742853 GTGAAGACACAGAGAGATGATGG + Intergenic
984210078 4:176836590-176836612 CTGAGGACACAGCGAGAAGATGG + Intergenic
985021845 4:185699969-185699991 TTGCAGACACAGTCGGAACAGGG - Intronic
985268784 4:188175275-188175297 CTCAGGACAGAGACTGAACAAGG + Intergenic
985632272 5:1020096-1020118 CTGAAGACAAAGACAGTAGCAGG + Intronic
986011336 5:3718602-3718624 CTGAAGACCCAGAGAGAAGATGG + Intergenic
986064920 5:4225883-4225905 CTAGGGACACAGAGAGAACACGG - Intergenic
986538981 5:8824419-8824441 ATGAAGACACCCCCAGAACAAGG - Intergenic
986751479 5:10791850-10791872 GTGAAGACACAGGGAGAAGACGG + Intergenic
986948342 5:13051160-13051182 TTGAAGACAAAGAAAGAAAATGG + Intergenic
987024453 5:13910241-13910263 CTAAAGTCACAGGCATAACAAGG - Intronic
987222541 5:15805030-15805052 GTGAAGACACAGGGAGAAGATGG - Intronic
987458915 5:18182794-18182816 CTGAAGACAGAGACAAAGCTTGG - Intergenic
987729415 5:21749213-21749235 GTGAACACACAGAGAGAAGACGG + Intergenic
988422815 5:31026889-31026911 ATGAAGACACAGGGAGAAGATGG + Intergenic
988724489 5:33912560-33912582 CTGAAGGCAGAGACAGAAATTGG + Intergenic
988785112 5:34559679-34559701 CTGAAGACACAGGCAAAAGATGG - Intergenic
988998896 5:36740946-36740968 ATGAAGACACAGGGAGAACCTGG - Intergenic
989001958 5:36770609-36770631 GTGAAGGCACAGAGAGAAAATGG - Intergenic
989119138 5:37986021-37986043 CTGAAGGGAAAGACAAAACAAGG + Intergenic
989254889 5:39355820-39355842 GTGAAGACACAGGGAGAAGATGG - Intronic
989518617 5:42374510-42374532 CTGAAGACACAGAAATCAAATGG + Intergenic
990605720 5:57407925-57407947 TTGAAGACACAGAGAGAAGATGG + Intergenic
991021790 5:61987032-61987054 GTGAAGACACAGTGAGAAGATGG + Intergenic
991335884 5:65546735-65546757 GTGAAGACACAGGAAGAAGATGG + Intronic
992391888 5:76337239-76337261 CTGAAGACACAGAGAGAAGATGG - Intronic
992883806 5:81137671-81137693 GTGAAGACACAGGAAGAAGACGG + Intronic
993003878 5:82410566-82410588 GTGAAGACACAGAACGAAGATGG + Intergenic
993042679 5:82833360-82833382 TTGAAGTTACAGAAAGAACAGGG + Intergenic
993255077 5:85580549-85580571 GTGAAGACACAGTCAGAAGGAGG - Intergenic
993593298 5:89822951-89822973 GTGAAGACACAGTGAGAATATGG + Intergenic
994282498 5:97922233-97922255 GAGAAGACACAGAGAGAATATGG - Intergenic
994550276 5:101225736-101225758 GTGAAGGCACAGGCAGAAGATGG + Intergenic
994834600 5:104833135-104833157 GTGAAGATTCAGCCAGAACATGG + Intergenic
995229044 5:109737711-109737733 ATGTAGACACACACAGAACATGG + Intronic
995396898 5:111696742-111696764 GTGAGGACACAGAGAGAAGATGG - Intronic
995516722 5:112961656-112961678 TTGAACACCCAGACAGAAAATGG + Intergenic
995751316 5:115455991-115456013 CTGAATACACAGAGAGGAAAGGG - Intergenic
995913427 5:117214922-117214944 CTGAAGAAACAGCCAAAAGAAGG - Intergenic
996263269 5:121500884-121500906 GTGAAGACACAGGGAGAAGATGG + Intergenic
996509118 5:124299295-124299317 GTGAAGACACAGGGAGAAGATGG - Intergenic
996731786 5:126724165-126724187 CTGAAATCACAGAGAAAACAAGG + Intergenic
997202239 5:132017978-132018000 CTGGAGAGAGAGAGAGAACAGGG + Intergenic
997409310 5:133679048-133679070 GGGAAGACACAGACAGAACCTGG + Intergenic
997464484 5:134078250-134078272 CTGCACACACAGACAGAGGAGGG + Intergenic
997806140 5:136920103-136920125 ATCAAGACACAGGCAGAAAAGGG - Intergenic
998340438 5:141413091-141413113 CTGAAGCCACAGAAAGACAAAGG + Intronic
998652836 5:144140814-144140836 GTGAAGACACAGGGAGAAGATGG + Intergenic
998918227 5:147039432-147039454 CTGAAGACCCAGATAGATCCCGG + Intronic
999340555 5:150766980-150767002 CTGAAGATATAGAAAGAAGAAGG + Intergenic
999554594 5:152726834-152726856 CAGAAAACACAGACTGAAAATGG - Intergenic
1000393489 5:160749085-160749107 CTGGAGTCGCAGAAAGAACATGG - Intronic
1000725665 5:164767599-164767621 CTCAATAGACATACAGAACATGG - Intergenic
1001349509 5:170945297-170945319 CGTAAGGCACAGAAAGAACATGG + Intronic
1001370800 5:171198829-171198851 CTGAAGAAACAGGCAGAGAAAGG - Intronic
1001542355 5:172548454-172548476 CTGAACAAACAGACAATACAAGG - Intergenic
1001852615 5:174982732-174982754 GTGAAGACACAGGGAGAAGATGG - Intergenic
1003635519 6:7828349-7828371 CTGAACACACAAACAGAACAGGG - Intronic
1003850547 6:10218099-10218121 CAGAAGCCACAGAAAGAACTGGG - Intergenic
1004017720 6:11747370-11747392 CAGAAGACACAAAAAGCACAAGG + Intronic
1005973596 6:30780254-30780276 CTGAAGGCCCAGAGTGAACAGGG - Intergenic
1006093904 6:31644205-31644227 CAGAAGAGACAGACCGAAGAGGG + Intronic
1006917494 6:37603923-37603945 CTGATGCCACAGAGAGCACAGGG - Intergenic
1007670981 6:43553571-43553593 CAGAAGACACAGAGAGACAATGG + Intronic
1008487583 6:52052458-52052480 CTGGAGAGACAGAAAGGACAAGG + Intronic
1008649380 6:53547619-53547641 CTAAAGACACTGAGAGATCAAGG - Intronic
1009527250 6:64763382-64763404 CTGGAGAGAGAGACAGAGCAAGG + Intronic
1010082609 6:71881714-71881736 GTGGAGACACAGGCAGAAAATGG - Intergenic
1010273323 6:73939693-73939715 GTGAAGACACAGGGAGAAGATGG + Intergenic
1012323068 6:97876729-97876751 CAAAACACACAAACAGAACAAGG + Intergenic
1013491651 6:110652747-110652769 ATGAAGACACAGAGAGAGAAAGG + Intronic
1013805234 6:113989405-113989427 GTGAGGACACAGAGAGAAGAGGG - Intronic
1014143161 6:117966698-117966720 GTGAAGACACAGGGAGAAGATGG - Intronic
1014677542 6:124385597-124385619 GTGAAGACCCAGACTGAACTGGG - Intronic
1014789630 6:125657796-125657818 ATGAAAAGACAAACAGAACAAGG + Intergenic
1014909018 6:127066599-127066621 GTGAAGACAGAGAGAGAAAATGG + Intergenic
1015203743 6:130612012-130612034 CTGAAGTCACACACAGTAAATGG - Intergenic
1015684671 6:135846667-135846689 GTGAGGACACAGACAGAAGGTGG - Intergenic
1015719710 6:136228448-136228470 GTGAAGACACAGCAAGAAGATGG + Intergenic
1015738072 6:136422914-136422936 CAAAAGACACAGACAGACCTGGG + Intronic
1016099771 6:140084878-140084900 GTGAAGACACAGAAAGAAGATGG + Intergenic
1017058969 6:150463212-150463234 CAGAAGACAAAGGCAGATCAGGG + Intergenic
1017213593 6:151883459-151883481 GTGAGGACACAGGCAGAAGACGG - Intronic
1017918066 6:158848006-158848028 GTGAAGACACAGGCAGAAGACGG + Intergenic
1018053034 6:160028217-160028239 GTGAAGACACAGAAAGAAAACGG - Intronic
1018714616 6:166521993-166522015 GTGAGGACACAGCCAGAAGATGG + Intronic
1019709003 7:2509894-2509916 CTGGAGACACAGCCAGGACAGGG + Intergenic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1021662499 7:22934362-22934384 CTGGAGAAACAAAAAGAACAGGG - Intergenic
1022218428 7:28288592-28288614 CTATAGAAACAGACAGATCAAGG + Intergenic
1022539960 7:31126170-31126192 GTGAGGACACAGAGAGAAGACGG + Intergenic
1022863985 7:34398385-34398407 GTGAGGACACAGAGAGAAGATGG - Intergenic
1022916547 7:34961289-34961311 AAGAAGACACAAACAGATCAAGG + Intronic
1023544963 7:41308780-41308802 GTAAAGACACAGAGAGAAGACGG + Intergenic
1024103582 7:46058734-46058756 GTGAAGATACAGGCAGAAGATGG + Intergenic
1024667993 7:51564954-51564976 CTGAAGAAACGGAGAGTACAGGG - Intergenic
1026490043 7:70855466-70855488 CTAGAGTCACAGACAGAGCAGGG - Intergenic
1027986085 7:85292124-85292146 GTGAAGACACAGGGAGAAGATGG + Intergenic
1028202342 7:87976424-87976446 GTGAGGACACAGAGAGAAAATGG + Intronic
1029132865 7:98346775-98346797 CTGAAGACACAGAAATGAAATGG + Intronic
1029331754 7:99862443-99862465 CTGCAGACACAAACAGGACCAGG - Intronic
1029683308 7:102127775-102127797 ATGAAGGCATAGAAAGAACAGGG - Intronic
1029818533 7:103122422-103122444 CGGTAGACACAGACAAAAGAGGG + Intronic
1031240534 7:119232616-119232638 CTGAAAACACAGAAAGTACTGGG - Intergenic
1031357773 7:120809009-120809031 GTGAAGACACAGGGAGAAGATGG + Intronic
1031372169 7:120981705-120981727 GTGAAGATGCAGAGAGAACAGGG - Intergenic
1032546480 7:132748060-132748082 GTGAAGACACAGAGAGAAGGTGG - Intergenic
1032602083 7:133308427-133308449 GTGAAGACACAGGGAGAAGATGG + Intronic
1032661794 7:133992103-133992125 TTGAAGACACACACACAAAATGG - Intronic
1033321655 7:140345270-140345292 GGGAAGACACAGACAAACCATGG + Intronic
1034110737 7:148535439-148535461 CTGAAGACAGAAACTGAACAGGG + Intergenic
1034129957 7:148706580-148706602 CTGAAGACACATACTGAAATTGG + Intronic
1034391145 7:150788549-150788571 CTGAGGACACAGGGAGAAGACGG - Intergenic
1034392074 7:150794573-150794595 CTGAAGACACACACTGAGGAGGG + Intronic
1034675838 7:152891912-152891934 ATGAAGACACAGGGAGAAGACGG + Intergenic
1034745885 7:153523760-153523782 GTGAAGACTCAGAGAGAAGACGG - Intergenic
1035081100 7:156216640-156216662 GTGAGGCTACAGACAGAACAAGG + Intergenic
1035865117 8:3074180-3074202 ATGAAGAAAGACACAGAACATGG - Intronic
1035913314 8:3593249-3593271 CTGAACACACAGACACAACGCGG - Intronic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1036295472 8:7531804-7531826 CTGATGACAAAGATAGAACAAGG - Intergenic
1036327097 8:7789215-7789237 CTGATGACAAAGATAGAACAAGG + Intergenic
1036766271 8:11551092-11551114 CTGAAAAAACAGACAAGACATGG - Intronic
1037305552 8:17499419-17499441 CTGAACACACAGAGAGAGAAGGG - Intronic
1037422949 8:18723592-18723614 CTGGAGATACAGAAGGAACAGGG - Intronic
1037618872 8:20545603-20545625 CTGCAGGCAAAGACAGACCATGG + Intergenic
1037744974 8:21635931-21635953 CTGAAGTCACTGAAAAAACAGGG + Intergenic
1037764539 8:21764270-21764292 GTGAGGACACAGCCAGAAGATGG - Intronic
1038286840 8:26212819-26212841 CTGAGGACACAGTAAGAAGACGG + Intergenic
1038488921 8:27955594-27955616 CTAAAAACAGAGACAGACCAGGG + Intronic
1039092400 8:33846175-33846197 CTGAAGCCACAGAGAAAAAAGGG + Intergenic
1039471223 8:37814862-37814884 GAGAGGACACAGACAGGACAAGG - Intronic
1039800409 8:40949802-40949824 GTGAAGACACAGAAAGAAGGTGG + Intergenic
1039818957 8:41119374-41119396 CTGAATGCACAGCAAGAACAAGG + Intergenic
1040636303 8:49277619-49277641 CTTAAGCCAAAGCCAGAACAAGG + Intergenic
1040705717 8:50124210-50124232 GTGAAGACACAGGGAGAAAATGG + Intronic
1040731970 8:50458211-50458233 CTGAGGAAACAGACAAAGCAAGG + Intronic
1040856026 8:51948768-51948790 TTGAAGACACAGAGAGAAGAGGG + Intergenic
1041273661 8:56134933-56134955 CTGTAGACAAAGACAAAGCAAGG - Intergenic
1041405144 8:57490754-57490776 GTGAAGACACAGGGAGAAAATGG + Intergenic
1041439935 8:57883509-57883531 GTGAAGACACAGGGAGAAGATGG + Intergenic
1041933316 8:63310326-63310348 CAGAAGAAACACAGAGAACATGG - Intergenic
1042106242 8:65329463-65329485 CTGAAGACAGAGAAAGAAAGAGG + Intergenic
1042473167 8:69214177-69214199 ATGAAGACACAGGGAGAAGATGG + Intergenic
1043211097 8:77519128-77519150 ATAAACACACAGAAAGAACAAGG - Intergenic
1043561659 8:81500582-81500604 CTGGAAACACAGGCATAACATGG - Intergenic
1043938104 8:86166253-86166275 TTGAATAAACAGACAGTACATGG - Intergenic
1044167372 8:89003310-89003332 GTAAAGACACAGAGAGAAGAGGG + Intergenic
1044937338 8:97305831-97305853 GTGAAGACACAGCAAGAAGATGG - Intergenic
1044954793 8:97468740-97468762 CTGAAGAACCAGACAGGAAAGGG - Intergenic
1044989598 8:97783786-97783808 CTGAAGTTACAGAAAGAATAGGG - Intronic
1045487242 8:102640992-102641014 GTGAAGACACAGGGAGAAGATGG + Intergenic
1045507274 8:102787705-102787727 CTGAAGACAGAGACAGAGATTGG - Intergenic
1045660550 8:104433063-104433085 GTGAAGACACAGGAAGAAGATGG + Intronic
1046308094 8:112397616-112397638 GTGAGGACACAGCCAGAAGACGG - Intronic
1046637223 8:116683377-116683399 CTGAGGACACAGTGAGAAAATGG - Intronic
1047004718 8:120608498-120608520 ATGAAGACACAGAGAGAAGACGG + Intronic
1047028197 8:120847593-120847615 ATGAAGACACAGAAAGAAGCTGG + Intergenic
1047193544 8:122700495-122700517 CTGAAGACACAGGGAGAGGATGG + Intergenic
1047686435 8:127309339-127309361 ATGAAGAAACTGACATAACAGGG - Intergenic
1048148090 8:131865127-131865149 GTGAAGACACAGGGAGAAGACGG + Intergenic
1048169419 8:132091322-132091344 TTGAAGCCACACACAAAACATGG + Intronic
1048579178 8:135716789-135716811 CTGCAGACACACAGTGAACAAGG - Intergenic
1048767581 8:137861618-137861640 GTGAAGACAGAGACAGAAAGTGG + Intergenic
1048936921 8:139365141-139365163 GTGAGGACACAGAGAGAAGACGG - Intergenic
1049509582 8:143020786-143020808 ATGAGGACACAGACAGCAGAGGG - Intronic
1049798781 8:144508380-144508402 CTGAAGCCACAGACACAGCAAGG + Intergenic
1050169278 9:2798364-2798386 TTGAAGAAACAGACAAGACATGG - Intronic
1050361812 9:4837616-4837638 CTGCACACCCAGAGAGAACAAGG - Intronic
1051739463 9:20237532-20237554 CTGAAGACACAGACTAGAGAAGG + Intergenic
1053091978 9:35286873-35286895 ATGAAGAAATACACAGAACAAGG - Intronic
1053532286 9:38894652-38894674 GTGAAGACACAGGGAGAAGACGG + Intergenic
1053884412 9:42632084-42632106 CTGTAGATATATACAGAACAGGG - Intergenic
1053888256 9:42662210-42662232 CTGTAGATATATACAGAACAGGG + Intergenic
1054204511 9:62119061-62119083 GTGAAGACACAGGGAGAAGACGG + Intergenic
1054223436 9:62439531-62439553 CTGTAGATATATACAGAACAGGG - Intergenic
1054227275 9:62469656-62469678 CTGTAGATATATACAGAACAGGG + Intergenic
1054633851 9:67469303-67469325 GTGAAGACACAGGGAGAAGACGG - Intergenic
1055262138 9:74449476-74449498 ATGAAGACACAGGGAGAAGATGG - Intergenic
1055686402 9:78779690-78779712 GTGAAGACAGAGACATAGCAGGG - Intergenic
1055904128 9:81273023-81273045 GTGAAGACACAGACAGAAGGTGG + Intergenic
1056194460 9:84215758-84215780 CTGAAGAAACAAACAAAGCAGGG - Intergenic
1056507592 9:87271614-87271636 CTGAAGACACGGAGTGAAGAAGG - Intergenic
1056520077 9:87393027-87393049 CTGAATACACAAACAGATGATGG + Intergenic
1056765992 9:89444939-89444961 CTGAACATCCCGACAGAACAGGG + Intronic
1057370938 9:94472402-94472424 CTGAGGGGCCAGACAGAACAGGG - Intergenic
1057424081 9:94934824-94934846 CTGAAGACACAGGCAGGCAAAGG - Intronic
1057904852 9:98975531-98975553 ATGAAGAAACAAACAGAGCAGGG - Intronic
1058133021 9:101274849-101274871 CTGAACCCACAGAAGGAACATGG - Intronic
1058154767 9:101502779-101502801 CTGAAGACTCTGACAGAGCCAGG - Intronic
1058547741 9:106078874-106078896 CTAAAGTCACAGACATAATAAGG + Intergenic
1058844395 9:108941989-108942011 TGGAAGACAAAGACAGAATAAGG - Intronic
1058918425 9:109589831-109589853 TTGAAGACACACACAAAAAATGG - Intergenic
1058926479 9:109668831-109668853 CTTAAGACACAATCAGAAAATGG - Intronic
1058933797 9:109748851-109748873 GTGAAGACACAGGGAGAAGATGG - Intronic
1058983182 9:110188875-110188897 GTGAGGACACAGCCAGAAGATGG + Intergenic
1059097700 9:111436323-111436345 CTGATGACACAGACACAGTAAGG + Intronic
1059167947 9:112096979-112097001 CTGCTGATACAGACAGGACAAGG + Intronic
1059243975 9:112833996-112834018 TTGAAGATACAGACAGGAGAGGG + Intronic
1059366322 9:113789244-113789266 CTGAGGACACTGAGAGACCAAGG - Intergenic
1059387809 9:113978538-113978560 CTGAGCATACAGACAGAACTGGG - Intronic
1061805621 9:133136218-133136240 CAGAAGGCAAAAACAGAACAGGG + Intronic
1062194275 9:135264263-135264285 CTGATGACCCACAGAGAACAGGG - Intergenic
1185514713 X:690844-690866 CTGAAAATACAGACGGGACACGG - Intergenic
1185704736 X:2258289-2258311 GTGAGGACACAGAGAGAAGATGG + Intronic
1185773885 X:2786827-2786849 ATGAAGACACAGGGAGAAGACGG + Intronic
1185790209 X:2923600-2923622 CTGAGGACACAGGGAGAAGATGG - Intronic
1185800661 X:3007613-3007635 GTGAAGACACAGGGAGAAGACGG - Intronic
1185848493 X:3463259-3463281 CTGAAGGCCCAAACAGAAAAAGG - Intergenic
1186044142 X:5516071-5516093 GTGAAGACACAGGGAGAAGAAGG - Intergenic
1186129250 X:6448581-6448603 ATGAAGACACAGGGAGAAGATGG - Intergenic
1186134558 X:6505401-6505423 CTGAATACACATATAAAACATGG + Intergenic
1187068958 X:15868946-15868968 ATGAAGACACAGTGAGAAGATGG - Intergenic
1187352692 X:18535582-18535604 CTGAATCCATAGACAGACCACGG - Intronic
1187992780 X:24893946-24893968 CTGAAGGCAGAGACAGAAAAAGG - Intronic
1188285865 X:28324841-28324863 CTAAATCCACAGACAGAAGAGGG + Intergenic
1188347394 X:29083902-29083924 CTGAAGACACAAACACTACCTGG - Intronic
1188649713 X:32617058-32617080 CTGAATCCACAGACAGAGAAAGG + Intronic
1189275199 X:39780423-39780445 GTGAAGACACAGCGAGAAGACGG + Intergenic
1192005585 X:67208528-67208550 CTTGAGAGGCAGACAGAACAGGG + Intergenic
1192051903 X:67732231-67732253 CTGAAGGCACAGACAGTGCATGG - Intergenic
1192233123 X:69279335-69279357 CAGAAGAGACAGAGGGAACAGGG - Intergenic
1193988161 X:88272876-88272898 ATGAAGACACAGGGAGAAGATGG - Intergenic
1195286611 X:103391447-103391469 CTGAAGCCACAGAAATAAAAAGG + Intergenic
1195345902 X:103951064-103951086 GTGAAGACACAGGGAGAAGATGG - Intronic
1195361703 X:104088450-104088472 GTGAAGACACAGGGAGAAGATGG + Intergenic
1195461320 X:105128655-105128677 CAGAAGAAAAAGAAAGAACACGG - Intronic
1195465626 X:105176173-105176195 CTGCAGAGACAGTCAGTACATGG + Intronic
1195935442 X:110121144-110121166 CTGAAGTCAAAGAGAGAACAAGG - Intronic
1197788430 X:130224239-130224261 GTGAAGACACAGTGAGAATATGG + Intronic
1197989218 X:132299046-132299068 CCAAGGACACATACAGAACAGGG + Intergenic
1198703034 X:139417660-139417682 GTAAAGACACAGAGAGAAGATGG + Intergenic
1198805466 X:140490018-140490040 CTGAATAAACATACAGAAAATGG + Intergenic
1199064548 X:143399555-143399577 CTGAAGACAGTTGCAGAACATGG - Intergenic
1199349671 X:146786340-146786362 CAGAAGAGAGAGACAGTACAGGG - Intergenic
1199516987 X:148689146-148689168 GTGAAGACACAGAAAGAAGATGG - Intronic
1200849637 Y:7869726-7869748 ATGAATACACAGAGAGAAAAAGG + Intergenic
1201231405 Y:11868233-11868255 GTGAAGACACAGGGAGAAGATGG + Intergenic
1201284103 Y:12364337-12364359 CTGAGGACACAGGGAGAAGATGG + Intergenic
1201295812 Y:12462325-12462347 ATGAAGACACAGGGAGAAGACGG - Intergenic