ID: 1132375277

View in Genome Browser
Species Human (GRCh38)
Location 15:101324621-101324643
Sequence GCATCACTTGGAACTTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 127}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132375275_1132375277 -8 Left 1132375275 15:101324606-101324628 CCAGGATGTCTCTCAGCATCACT 0: 1
1: 0
2: 2
3: 29
4: 230
Right 1132375277 15:101324621-101324643 GCATCACTTGGAACTTCTCCTGG 0: 1
1: 0
2: 0
3: 9
4: 127
1132375274_1132375277 1 Left 1132375274 15:101324597-101324619 CCTGGACAGCCAGGATGTCTCTC 0: 1
1: 0
2: 1
3: 18
4: 172
Right 1132375277 15:101324621-101324643 GCATCACTTGGAACTTCTCCTGG 0: 1
1: 0
2: 0
3: 9
4: 127
1132375273_1132375277 2 Left 1132375273 15:101324596-101324618 CCCTGGACAGCCAGGATGTCTCT 0: 1
1: 0
2: 2
3: 18
4: 205
Right 1132375277 15:101324621-101324643 GCATCACTTGGAACTTCTCCTGG 0: 1
1: 0
2: 0
3: 9
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132375277 Original CRISPR GCATCACTTGGAACTTCTCC TGG Intronic