ID: 1132375538

View in Genome Browser
Species Human (GRCh38)
Location 15:101326043-101326065
Sequence CTTGAATCGCATCCGTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 32}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132375530_1132375538 11 Left 1132375530 15:101326009-101326031 CCCCTGAGCTGGCCTGTGAGGAC 0: 1
1: 0
2: 4
3: 28
4: 238
Right 1132375538 15:101326043-101326065 CTTGAATCGCATCCGTCTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 32
1132375532_1132375538 9 Left 1132375532 15:101326011-101326033 CCTGAGCTGGCCTGTGAGGACAG 0: 1
1: 0
2: 5
3: 30
4: 320
Right 1132375538 15:101326043-101326065 CTTGAATCGCATCCGTCTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 32
1132375535_1132375538 -1 Left 1132375535 15:101326021-101326043 CCTGTGAGGACAGCACCAGGGCC 0: 1
1: 0
2: 5
3: 22
4: 294
Right 1132375538 15:101326043-101326065 CTTGAATCGCATCCGTCTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 32
1132375525_1132375538 29 Left 1132375525 15:101325991-101326013 CCTGTCCAAGAGCCATGTCCCCT 0: 1
1: 0
2: 2
3: 10
4: 153
Right 1132375538 15:101326043-101326065 CTTGAATCGCATCCGTCTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 32
1132375531_1132375538 10 Left 1132375531 15:101326010-101326032 CCCTGAGCTGGCCTGTGAGGACA 0: 1
1: 0
2: 3
3: 30
4: 230
Right 1132375538 15:101326043-101326065 CTTGAATCGCATCCGTCTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 32
1132375528_1132375538 17 Left 1132375528 15:101326003-101326025 CCATGTCCCCTGAGCTGGCCTGT 0: 1
1: 0
2: 2
3: 38
4: 345
Right 1132375538 15:101326043-101326065 CTTGAATCGCATCCGTCTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 32
1132375526_1132375538 24 Left 1132375526 15:101325996-101326018 CCAAGAGCCATGTCCCCTGAGCT 0: 1
1: 0
2: 2
3: 26
4: 211
Right 1132375538 15:101326043-101326065 CTTGAATCGCATCCGTCTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132375538 Original CRISPR CTTGAATCGCATCCGTCTCC AGG Intronic
909272965 1:73647790-73647812 CTTCATTCGCATCCTTTTCCTGG - Intergenic
920056775 1:203198539-203198561 CTCAAATCGCATCCATCTCCAGG - Intergenic
1068812922 10:61276865-61276887 TGTGAATCTCATCCATCTCCTGG - Intergenic
1077238382 11:1496370-1496392 CCTGTAGCGCATCAGTCTCCTGG - Intronic
1091686701 12:2567537-2567559 CTCGGATCTCATCCCTCTCCTGG + Intronic
1096713395 12:53475073-53475095 CATGAAACCCATCCCTCTCCTGG + Intronic
1097336740 12:58392086-58392108 CTTGAGATGCATCAGTCTCCTGG - Intergenic
1098426395 12:70369524-70369546 CTTGAATCCCAGCCGCCTCCAGG + Intronic
1111708249 13:91778466-91778488 CTGGAATCTCATCTGTCTCTGGG + Intronic
1112743722 13:102504165-102504187 CTTGAAGAGCATCCATCTTCAGG + Intergenic
1122901124 14:104782711-104782733 CTTCACTCACACCCGTCTCCTGG - Intronic
1130310742 15:82751854-82751876 CATGAATAGCCTCCCTCTCCTGG + Intergenic
1132375538 15:101326043-101326065 CTTGAATCGCATCCGTCTCCAGG + Intronic
1134663525 16:16002114-16002136 CTTGACTTCCATCGGTCTCCTGG - Intronic
1143155615 17:4834125-4834147 CTTGAATTGCATCCTTTCCCTGG + Intronic
1143742855 17:8966540-8966562 CTTGACCCGCATCCTTCTGCAGG + Intergenic
1160874055 19:1289085-1289107 CTGGAGTCGCATCCGGCTGCAGG + Intronic
936450182 2:112628025-112628047 CCTGAATTGCCTCCATCTCCAGG + Intergenic
937219459 2:120333420-120333442 CGTGAATGGCATCCTCCTCCTGG + Intergenic
958269901 3:91486728-91486750 ATTGAATCACATCAGTCTTCTGG - Intergenic
982363573 4:154550407-154550429 CTTGCATCACATCCGCCGCCTGG - Exonic
994212274 5:97100258-97100280 CTTGAACTGCTTTCGTCTCCAGG + Intronic
997913776 5:137903169-137903191 CATGTATCTCATCCGTCTTCTGG + Intronic
1004698284 6:18054652-18054674 CTTGAATTGCTTCCATCTTCTGG - Intergenic
1008985251 6:57534617-57534639 ATTGAATCACATCAGTCTTCTGG + Intronic
1009173288 6:60427572-60427594 ATTGAATCACATCAGTCTTCTGG + Intergenic
1016481464 6:144486243-144486265 CTAGCAGAGCATCCGTCTCCTGG - Intronic
1017814416 6:158006464-158006486 CTTGAAACGCTTTCTTCTCCTGG + Intronic
1023056455 7:36293992-36294014 TTTGAAGCACATCCATCTCCAGG + Intronic
1023520498 7:41045831-41045853 CTAGAATGGCATCTGTCTCCTGG + Intergenic
1025234881 7:57227810-57227832 CTTGGAACGCATCCATCTCCAGG - Intergenic
1032171583 7:129589012-129589034 CTTAAATGACATCCGCCTCCCGG - Intergenic
1032515447 7:132503232-132503254 GTGGAATGGCATCTGTCTCCAGG - Intronic
1033174814 7:139114205-139114227 CTTGCATCGCTTCCATCTCCTGG + Intergenic
1037908716 8:22730599-22730621 CTTGAATCTCATCCATCCCCGGG - Intronic
1046190561 8:110789662-110789684 CTTAAATCAGATCAGTCTCCTGG + Intergenic
1196900963 X:120382524-120382546 CTTGCATTGCATCTGACTCCAGG + Intronic
1200984374 Y:9290310-9290332 TTTGAAGCACATCCATCTCCAGG - Intergenic
1202126069 Y:21569934-21569956 TTTGAAGCACATCCATCTCCAGG + Intergenic