ID: 1132376303

View in Genome Browser
Species Human (GRCh38)
Location 15:101330349-101330371
Sequence AGTCCAGGTGCAGCCTCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 274}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132376299_1132376303 12 Left 1132376299 15:101330314-101330336 CCTCTATTTCTTGGCAACTGCTC 0: 1
1: 0
2: 2
3: 13
4: 171
Right 1132376303 15:101330349-101330371 AGTCCAGGTGCAGCCTCCACTGG 0: 1
1: 0
2: 0
3: 20
4: 274
1132376297_1132376303 24 Left 1132376297 15:101330302-101330324 CCTCGCTCACTTCCTCTATTTCT 0: 1
1: 0
2: 5
3: 83
4: 1129
Right 1132376303 15:101330349-101330371 AGTCCAGGTGCAGCCTCCACTGG 0: 1
1: 0
2: 0
3: 20
4: 274
1132376296_1132376303 25 Left 1132376296 15:101330301-101330323 CCCTCGCTCACTTCCTCTATTTC 0: 1
1: 0
2: 4
3: 85
4: 1011
Right 1132376303 15:101330349-101330371 AGTCCAGGTGCAGCCTCCACTGG 0: 1
1: 0
2: 0
3: 20
4: 274
1132376294_1132376303 27 Left 1132376294 15:101330299-101330321 CCCCCTCGCTCACTTCCTCTATT 0: 1
1: 0
2: 3
3: 32
4: 454
Right 1132376303 15:101330349-101330371 AGTCCAGGTGCAGCCTCCACTGG 0: 1
1: 0
2: 0
3: 20
4: 274
1132376295_1132376303 26 Left 1132376295 15:101330300-101330322 CCCCTCGCTCACTTCCTCTATTT 0: 1
1: 0
2: 2
3: 31
4: 538
Right 1132376303 15:101330349-101330371 AGTCCAGGTGCAGCCTCCACTGG 0: 1
1: 0
2: 0
3: 20
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132376303 Original CRISPR AGTCCAGGTGCAGCCTCCAC TGG Intronic
900684681 1:3940532-3940554 AGCCCAGCTGCAGCGTCCAGAGG - Intergenic
901391570 1:8949471-8949493 AGTCCATGGGCAGCCTGCAGGGG + Intronic
901537437 1:9891600-9891622 ACCCCAGGTGCAGCCTCCTGGGG + Intronic
907451694 1:54549541-54549563 AGCTCAGGTGCTGCCTCCTCTGG + Intronic
907733055 1:57086424-57086446 AGTCCAGCTGCAGCCTGGCCAGG - Intronic
909759313 1:79269541-79269563 AGCCCCGGTGCAGGATCCACTGG + Intergenic
910292475 1:85612785-85612807 TATCCAGGAGTAGCCTCCACAGG - Intergenic
913644463 1:120843669-120843691 TGTAGCGGTGCAGCCTCCACTGG + Intergenic
913654938 1:120951717-120951739 TGTAGCGGTGCAGCCTCCACTGG + Intergenic
914082274 1:144419909-144419931 TGTAGTGGTGCAGCCTCCACTGG - Intergenic
914098829 1:144566921-144566943 TGTAGTGGTGCAGCCTCCACTGG + Intergenic
914375516 1:147070339-147070361 TATACAGGTGCAGCCTCCAGTGG + Intergenic
914531904 1:148529901-148529923 TGTAGCGGTGCAGCCTCCACTGG - Intergenic
914636488 1:149557833-149557855 TGTAGCGGTGCAGCCTCCACTGG + Intergenic
915104198 1:153522198-153522220 AGCCCTGGTGCAGGATCCACTGG + Intergenic
915767090 1:158374095-158374117 AGCCCAGGTGCGGTATCCACTGG - Intergenic
917003458 1:170386067-170386089 AGGCCAGGTGCAGCCCTCAGTGG + Intergenic
917902819 1:179560004-179560026 AGTCATGGTGCTGCCTCCCCAGG + Intronic
919733853 1:200932150-200932172 TGACCAGGGGCTGCCTCCACTGG + Intergenic
920077464 1:203347781-203347803 GGTCCAGGTACAGCCTCTCCAGG + Exonic
920835323 1:209505624-209505646 AGCCCAGCTGAGGCCTCCACTGG - Intergenic
921983598 1:221285597-221285619 AGTCCTGGTGCGGGATCCACTGG - Intergenic
922543568 1:226436994-226437016 TGTCCAGGTGCAGCCTCCTTTGG - Intergenic
923269149 1:232339099-232339121 AGTACAGGTGAAGCCTCACCTGG + Intergenic
923573895 1:235140715-235140737 AGCCCCGGTGCAGGATCCACTGG + Intronic
924021181 1:239785227-239785249 AGTTCAGGTCCAGCATCCTCAGG + Intronic
1062938173 10:1403118-1403140 AGGCCGGCTGCTGCCTCCACTGG + Intronic
1064016001 10:11772922-11772944 AGTTCACCTGCAGCTTCCACAGG + Intergenic
1064423998 10:15214059-15214081 AGAGAAGGTCCAGCCTCCACGGG - Exonic
1064642420 10:17428241-17428263 TGTCCTGGTGCAGCCGCCATCGG + Intronic
1065825011 10:29562805-29562827 AGGCCTGGGGCAGCCTCCAGAGG + Intronic
1065952394 10:30664015-30664037 AGACCTGGGGCAGCCTCCAGAGG - Intergenic
1066003351 10:31125140-31125162 AGGCCAGGGGCAGCCTTCAGAGG - Intergenic
1066088951 10:31998961-31998983 TATCCAGGTGAAGCCTCCACAGG - Intergenic
1066544169 10:36481937-36481959 AGGCCCGGTGCAGGATCCACTGG - Intergenic
1067727073 10:48778506-48778528 AGCCCAGGTGCAGCACCTACTGG - Intronic
1069751918 10:70750341-70750363 AGTCCAGGAGCAGCTTCCTCGGG + Intronic
1070820387 10:79350777-79350799 AGCCCAGCTGAAGCATCCACAGG - Intronic
1071041011 10:81309014-81309036 AGTCCCGGTGCGGGATCCACTGG - Intergenic
1071055762 10:81506194-81506216 AGCCCTGGTGCAGGATCCACTGG + Intergenic
1071573433 10:86710211-86710233 AGACCAGATGCAGGCTCCATAGG - Intronic
1071797010 10:89018593-89018615 AGCCCCGGTGCAGGATCCACGGG - Intergenic
1074884529 10:117684005-117684027 TGTTCAGGGGCAGCCTCCCCCGG + Intergenic
1075928472 10:126272766-126272788 AGGCCATGTGCTGCCTCCAGGGG + Intronic
1076479156 10:130772922-130772944 AGGGCAGGGGCTGCCTCCACGGG - Intergenic
1076753894 10:132558112-132558134 TGTCCAGGTGGAGGCTCCGCAGG + Intronic
1077242412 11:1517505-1517527 AGGCCATGATCAGCCTCCACAGG - Intergenic
1077778140 11:5294382-5294404 AGCCCAGGTGCGGGATCCACTGG - Intronic
1079187302 11:18248928-18248950 AGCCCAGGTGCCGCCATCACGGG - Intergenic
1079189498 11:18265955-18265977 AGCCCAGGTGCCGCCATCACGGG + Intergenic
1081420975 11:42874334-42874356 AGCCCTGGTGCAGGATCCACTGG + Intergenic
1082698683 11:56401859-56401881 AGCCCCGGTGCAGGATCCACTGG - Intergenic
1082894319 11:58173895-58173917 GGTCCAGGTGCAGCTTCCCTTGG - Intronic
1083546186 11:63550625-63550647 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1084218461 11:67664151-67664173 AGTCCAAGTGCAGGCTGCTCTGG + Intronic
1084272492 11:68036703-68036725 AGTCCAGTTGGAGGCACCACAGG - Intergenic
1084486684 11:69452255-69452277 AGTCCTGGTTCTGCATCCACTGG - Intergenic
1086290344 11:85301651-85301673 AGTCCTGGTTCAGCCACTACTGG - Intronic
1086808096 11:91269177-91269199 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1088783846 11:113163099-113163121 AATCCAAGTGCAGCCTCATCTGG + Intronic
1089712249 11:120324169-120324191 ATTCAAGGTACAGCCTGCACAGG + Intergenic
1090477556 11:127037272-127037294 AGGCCAGGAACAGCCACCACAGG - Intergenic
1091538999 12:1441872-1441894 ATTCCAGGTGCAGTCTTCAAAGG - Intronic
1091715470 12:2773388-2773410 AGGCCAGGTGGAGTCTCCACAGG + Intergenic
1092137505 12:6159896-6159918 AGCCCAGGTGCGGGATCCACTGG + Intergenic
1092289442 12:7150490-7150512 TGCCCAGGTCCTGCCTCCACTGG + Intronic
1092583759 12:9876110-9876132 AGCCCAGGTGCGGGATCCACTGG - Intergenic
1094202939 12:27811680-27811702 AAGCCAGCTGCAGCCACCACTGG - Intergenic
1094489752 12:30952278-30952300 AGACCAGGTGCAGCGTCTCCTGG - Intronic
1097767515 12:63542871-63542893 AGTCCAGCTGCAGCCACAGCGGG - Intergenic
1097783881 12:63737919-63737941 AGTCCAGCTGCAGCCACAGCGGG - Intergenic
1102004390 12:109579970-109579992 AGTCCAGATTCAGCCTCCCATGG + Intronic
1102345905 12:112161356-112161378 AGTCCAGATGGAGACTCCAGGGG - Exonic
1104960327 12:132485565-132485587 AGGCTAGGACCAGCCTCCACGGG - Intergenic
1105016399 12:132788534-132788556 AGCCCAGGCTCAGCTTCCACAGG + Intronic
1105876609 13:24560645-24560667 AGCCCTGGTGCAGGATCCACTGG - Intergenic
1107390127 13:39954981-39955003 ACTCTAGATGCAGCCTGCACAGG + Intergenic
1108690854 13:52857831-52857853 AGTCCAGCAAAAGCCTCCACTGG - Intergenic
1109563093 13:64077474-64077496 AGCCCCGGTGCAGGATCCACTGG - Intergenic
1110281126 13:73695628-73695650 CTTCCAGGTGCAGCCTTCCCAGG + Exonic
1111674089 13:91366024-91366046 ACTCCAGGTTCAACCTCCCCAGG - Intergenic
1115835548 14:37397937-37397959 ATTCAATGTGCAGACTCCACAGG - Intronic
1115993926 14:39175789-39175811 TGTCCACGTGCAGCCTCCTCGGG + Intronic
1116223117 14:42113432-42113454 AGCCCCGGTGCAGGATCCACTGG - Intergenic
1116755265 14:48940431-48940453 AGTCTAGGTGGGGCCTCCAGGGG - Intergenic
1117067359 14:52023823-52023845 AATCCAAGTGCAGCCTCTCCAGG + Intronic
1118067467 14:62207385-62207407 AGGCCAGAGGCATCCTCCACAGG - Intergenic
1118610213 14:67533607-67533629 AGGCCAGGAGGAGCCTCCCCCGG + Intronic
1125599959 15:40910059-40910081 GGACCAGCTGGAGCCTCCACTGG + Intergenic
1127371804 15:58348485-58348507 ATGACAGGTGCAGCCTCTACAGG + Intronic
1127460519 15:59194517-59194539 ACTCCAGGTTTAGCTTCCACAGG - Intronic
1127765991 15:62186503-62186525 AGCCCTGGTGCAGGATCCACTGG - Intergenic
1127967265 15:63931640-63931662 TGTCCAGGGGCAGGCTCCAGGGG + Intronic
1128613119 15:69089543-69089565 AATCCACCTGCAGCCTCCAGTGG - Intergenic
1129373939 15:75115935-75115957 AGCCCCGGTGCAGGATCCACTGG - Intronic
1129986966 15:79926496-79926518 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1130400450 15:83547265-83547287 AGTCTAAGTGCTCCCTCCACGGG + Intronic
1132376303 15:101330349-101330371 AGTCCAGGTGCAGCCTCCACTGG + Intronic
1132527995 16:426791-426813 ACTCCAGGGGCAGCGTCGACCGG - Intronic
1132774610 16:1586114-1586136 AATCCAGGTACAGCCTCCAAGGG - Exonic
1133376207 16:5289312-5289334 ATTCCAGGAGCAGGTTCCACTGG + Intergenic
1135987318 16:27193545-27193567 ACTTCTGCTGCAGCCTCCACAGG + Intergenic
1136025205 16:27464338-27464360 CGGCCAGGCGCAGCCTCCAGAGG - Exonic
1136046378 16:27618346-27618368 AGTGCAGGTGCAGCACACACCGG - Intronic
1139600358 16:67982644-67982666 GGCCCCGGTGCAGCATCCACTGG + Intergenic
1141152506 16:81573988-81574010 AGTCCAGGTAAAGGCTCCAGGGG - Intronic
1141839242 16:86564061-86564083 GCTCCAGGTGCAGCGGCCACGGG + Intergenic
1142223793 16:88867685-88867707 AAGCCAGGTGCAGACACCACCGG - Intergenic
1142560142 17:804870-804892 AGTGCAGCTGCAGCTCCCACAGG + Intronic
1142741850 17:1936198-1936220 ACTCCAAGTGCATCCTCCACTGG - Exonic
1144783863 17:17821308-17821330 GGCCCAGGTGCAGCCTTCCCTGG + Intronic
1147658477 17:42104583-42104605 AGTCCAGGTACTGCCTTCCCTGG + Intronic
1148016950 17:44528395-44528417 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1148343041 17:46884792-46884814 AGTCCAGCTGTCGCCTTCACTGG - Intronic
1151387986 17:73767052-73767074 AGTCCTCGTGCTGCCTCTACTGG - Intergenic
1151523487 17:74647818-74647840 AGCCCAGCTGCAGAGTCCACTGG + Intergenic
1151731412 17:75913780-75913802 GGTCCAGTTGCAGCCTCTGCTGG + Exonic
1152706098 17:81844460-81844482 AGTCCAGGCACAGTCACCACTGG + Intronic
1154183996 18:12164959-12164981 AGTACATATGCACCCTCCACTGG - Intergenic
1154298883 18:13175422-13175444 CGTCCAGGGTCAGCCTCCTCAGG - Intergenic
1155707804 18:28838068-28838090 AGCCCTGATGCAGTCTCCACTGG - Intergenic
1160515305 18:79476228-79476250 TGTCCACGTGCAGCCGCCTCCGG + Intronic
1160778827 19:868897-868919 CGCCAAGGTGCAGCCTCCGCAGG + Exonic
1161042321 19:2116733-2116755 CGTCCAGGTCCAGGCTGCACCGG + Exonic
1162107073 19:8376186-8376208 AGCCCCGGTGCAGGATCCACTGG + Intronic
1162230220 19:9259935-9259957 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1162632628 19:11941234-11941256 AGCCCTGGTGCAGGATCCACTGG - Intronic
1163136340 19:15314067-15314089 ACTCCAGGTGGACCCACCACTGG + Intronic
1163727675 19:18932011-18932033 CCTCCAGCTGCTGCCTCCACTGG + Exonic
1164826088 19:31285907-31285929 AGTCCAGCTGCCTCCTCCATGGG - Intronic
1168315660 19:55483719-55483741 AGTCCAGCTCCAGCCAGCACAGG + Exonic
924974934 2:163872-163894 AGTCCATGTGATGCTTCCACAGG - Intergenic
925278810 2:2669053-2669075 GGTCCAGGTGCAGCCACAGCGGG + Intergenic
926062790 2:9814515-9814537 AGACCAGGGGCAGCCCCCATAGG + Intergenic
926094644 2:10073240-10073262 AGTCCAGGGCCCGTCTCCACTGG + Intronic
926616556 2:15002473-15002495 AGTCCCGGTGCGGGATCCACTGG - Intergenic
926770113 2:16363940-16363962 AGTTAAGATGCAGACTCCACTGG - Intergenic
927818034 2:26237549-26237571 AGTGCAGCTTCAGCCTCCCCAGG - Intronic
930468156 2:51780274-51780296 AGCCCCGGTGCAGGATCCACTGG - Intergenic
931516658 2:63054192-63054214 AGTCCAGGTGCGCACTCCCCGGG + Exonic
933024091 2:77232523-77232545 AGTCCAGGTCCTTCTTCCACAGG + Intronic
935371911 2:102356111-102356133 TGCCCACCTGCAGCCTCCACCGG + Exonic
936346964 2:111682272-111682294 AGCCCCGGTGCAGGATCCACTGG + Intergenic
937004499 2:118499099-118499121 ATTCCAGCTGCTGCCTCCTCAGG + Intergenic
937218865 2:120329983-120330005 ACTCCAGGGGCAGCCCCGACTGG + Intergenic
937477205 2:122226340-122226362 AGTCCAGGTGTGGCCTCCTCTGG - Intergenic
938126005 2:128672061-128672083 AGCCCCGGTGCAGGATCCACTGG - Intergenic
946257205 2:218452443-218452465 AGTCCAGCTGAAATCTCCACTGG + Exonic
947412063 2:229851138-229851160 AGCCCCGGTGCAGGATCCACTGG + Intronic
947448822 2:230186128-230186150 GGTCCAGGGGCAGCCTCACCTGG - Exonic
947742607 2:232491466-232491488 TGGTCAGGTGCTGCCTCCACAGG + Intergenic
948609859 2:239159860-239159882 AGCCGAGGTGCAGCCCCCACGGG + Intronic
948833935 2:240615194-240615216 AGCCCAAGTGCAGTCTCCCCAGG + Intronic
949059274 2:241947398-241947420 CGCCCAGATGCAGCGTCCACGGG + Intergenic
1171869536 20:30514150-30514172 GGTCCAGGTGGATCCGCCACAGG - Intergenic
1172221259 20:33276618-33276640 TGTCCAGGTGCACTCTCCACAGG + Intronic
1172533382 20:35651349-35651371 AGTACAAGTGCAGCCGCCAGAGG - Exonic
1173293612 20:41735717-41735739 AGTACTGGTGAGGCCTCCACAGG + Intergenic
1174781642 20:53394899-53394921 CCTCCACATGCAGCCTCCACTGG + Intronic
1175677607 20:60960233-60960255 TCTCCAGGTGCAGGCTCCTCTGG - Intergenic
1175898694 20:62351486-62351508 AGGGCATGTGCAGCCTCCCCAGG - Intronic
1175953364 20:62595753-62595775 AGTAGAGCTGCAGCCTCCACTGG + Intergenic
1175955551 20:62607192-62607214 TTTCCAGGTGCAGCCTTCACGGG - Intergenic
1176144330 20:63558922-63558944 GGTCAAAGGGCAGCCTCCACAGG + Intronic
1178327066 21:31654607-31654629 AGCCCAGGTGCGGGATCCACTGG + Intergenic
1179548200 21:42126122-42126144 GGTTCAGGTGCTGCCTCCTCTGG + Intronic
1179677321 21:42992660-42992682 AGCACACGTGCAGACTCCACAGG + Intronic
1179925839 21:44533651-44533673 ACTGCAGGTGCACCCTCCCCGGG + Intronic
1180179775 21:46112738-46112760 ACTCGAGGTGCAGCCGCCCCAGG + Intronic
1181029046 22:20141215-20141237 AGTCCAAGGGCAGCCTGGACCGG + Exonic
1181050314 22:20235236-20235258 CCTGCAGGGGCAGCCTCCACGGG - Intergenic
1182353732 22:29712864-29712886 AGCCCAGGTGCTGCCTCCTGTGG + Intergenic
1183453915 22:37911200-37911222 ACTCCTGGGGCAGCCTCCATTGG - Intronic
1183591188 22:38780173-38780195 AGTCCAGGTGCAGGCGCCTGAGG + Intronic
1184296117 22:43526603-43526625 AGTCCTGGTGCTGCCTGCAGGGG + Intergenic
1184341771 22:43890094-43890116 AGGCCAGGTGCAGGCTCCTGAGG + Intronic
1184411931 22:44330990-44331012 AGTCCCCGTGCAGCCCGCACGGG + Intergenic
952226853 3:31386512-31386534 AGCCCAGGTGCAGCCCTCAGGGG - Intergenic
953418448 3:42736262-42736284 GGTCCAGGTACTGCCTCCAAGGG - Intronic
955414946 3:58683534-58683556 AGTCCAGGTGCATCTTAAACAGG + Intergenic
956195814 3:66651949-66651971 AGCCCCGGTGCAGGATCCACTGG + Intergenic
956597925 3:70988554-70988576 AGGCCAGGAGCAGGCTCCAAGGG + Intronic
960044107 3:113179669-113179691 AGTCCAGGTCAGGCCTCCAAGGG - Intergenic
960638660 3:119807880-119807902 ACTCCAGGTGCACCCTCCGGAGG + Intronic
960673211 3:120171475-120171497 ATTCCAGGTGTAGCGTGCACTGG + Intronic
963589917 3:147245543-147245565 AGCCCCGGTGCAGGATCCACTGG - Intergenic
963651753 3:147989315-147989337 AGTCCTGGTGCGGGATCCACTGG - Intergenic
963742847 3:149097659-149097681 AGCCCAGGTGCAGGATCCACTGG - Intergenic
963744229 3:149109778-149109800 AGCCCGGGTGCAGGATCCACTGG + Intergenic
965003596 3:162987741-162987763 CGGCCAGGTGCAGGATCCACTGG + Intergenic
966190938 3:177271666-177271688 AGCCCCGGTGCAGGATCCACTGG - Intergenic
966338836 3:178902612-178902634 AGACCTGGGGCACCCTCCACAGG + Intergenic
967499077 3:190176987-190177009 AGCCCCGGTGCAGGATCCACTGG - Intergenic
968448886 4:665929-665951 AGGCCAGGTGCAGCCTCGGCAGG + Intronic
970051314 4:11918056-11918078 AGTCCCAGTGCAGGATCCACTGG + Intergenic
971072797 4:23113783-23113805 AGGCCAGGTGCAGGGTCCCCAGG - Intergenic
973387709 4:49524465-49524487 TGTCCCGGTGCAGCCGCCCCTGG - Intergenic
974263877 4:59559877-59559899 AGTGGATCTGCAGCCTCCACTGG - Intergenic
974484710 4:62491835-62491857 AGCCCAGGTGCAGGATCCACTGG - Intergenic
974590513 4:63942820-63942842 AGCCCAGGTGCGGGATCCACTGG - Intergenic
976755349 4:88491914-88491936 AGTAGGGGTGCAGCCTCCTCGGG + Intronic
979224269 4:118265976-118265998 GGTCCAGGTACAGGATCCACTGG + Intergenic
979688669 4:123538339-123538361 AGCCCAGGTGCGGGATCCACTGG + Intergenic
982868727 4:160550046-160550068 AGCCCCGGTGCAGGATCCACTGG - Intergenic
984238742 4:177193134-177193156 AGCCCAGGTGCGGGATCCACCGG - Intergenic
984241767 4:177227503-177227525 AGCCCCGGTGCAGGATCCACTGG - Intergenic
984770640 4:183433567-183433589 AGCCCCGGTGCAGGATCCACTGG + Intergenic
985824500 5:2182230-2182252 TGTCCAGCTGCACCCTGCACAGG + Intergenic
987383935 5:17311711-17311733 AGCCCCGGTGCAGGATCCACTGG - Intergenic
988931019 5:36035676-36035698 AGGCCAGGTGCAGCCTTGGCGGG - Exonic
990948382 5:61272892-61272914 AGTCCAGGAGCAGCAGCGACAGG - Intergenic
992296811 5:75334108-75334130 AGCCCTGGTGCAGGATCCACTGG + Intergenic
992551547 5:77865087-77865109 AGTGGAGGAGCAGCCTACACAGG + Intronic
994096419 5:95851589-95851611 AGCCCAGGTGCGGGATCCACTGG + Intergenic
994263404 5:97686058-97686080 ACTACAGCTGCAGCCTCGACTGG - Intergenic
995568745 5:113457566-113457588 AGCCCAGGTGCAGGATCCACTGG + Intronic
997256226 5:132430248-132430270 AGGCCAACTGCATCCTCCACTGG + Intronic
997352286 5:133239382-133239404 AGACCTGGTGCAGGATCCACTGG + Intronic
997843648 5:137265697-137265719 AGTCCAGATAGAGCCTCCAAAGG + Intronic
999180277 5:149665248-149665270 AGTTCTGCTGCAGCCCCCACAGG - Intergenic
1000654307 5:163857805-163857827 AGACCAGCTGCAGGCACCACTGG + Intergenic
1002077560 5:176717969-176717991 GTTCCAGGTGCAGCTTCCAAAGG - Intergenic
1002522763 5:179800617-179800639 AGTCCGTATGCAGCCTCCAGGGG + Intronic
1003011367 6:2430444-2430466 TGTCCAGGTGCAGGCATCACAGG + Intergenic
1003845809 6:10172177-10172199 AGCCCAGGTGCGGGATCCACTGG + Intronic
1004053076 6:12108327-12108349 AGTCCTGGTGCAGGATCTACTGG - Intronic
1007151836 6:39701256-39701278 AGTCCTGGTCCAGCCCCCACGGG + Intronic
1007662439 6:43495129-43495151 CTACCAGGTGCAGCCTCCCCTGG - Intronic
1007738801 6:43998479-43998501 AGCCCTGGTGCAGGATCCACTGG + Intergenic
1008599571 6:53077774-53077796 AGTCCCTGTGCAGCCTTCATTGG + Intronic
1009407037 6:63326388-63326410 AGCCCTGGTGCAGAATCCACTGG - Intergenic
1011620027 6:89234426-89234448 AGCCCTGGTGCAGGATCCACTGG - Intergenic
1012335208 6:98047083-98047105 TGTCCAGGAGCAGGCTCCTCTGG - Intergenic
1012578155 6:100829169-100829191 AGCCCAGGTGCGGGATCCACTGG - Intronic
1013410710 6:109881083-109881105 AGCCCCGGTGCAGGATCCACTGG - Intergenic
1014507837 6:122281003-122281025 AGCCCAGGTGCGGGATCCACTGG + Intergenic
1014788549 6:125644876-125644898 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1015143420 6:129959585-129959607 GGTCCAGCTGCAGCCTCCCCGGG + Intergenic
1016067294 6:139697861-139697883 AGCCCCGGTGCAGGATCCACTGG - Intergenic
1016217278 6:141618637-141618659 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1016521127 6:144948199-144948221 TGTCCTGGGGCAGCCTCCATGGG + Intergenic
1016987286 6:149904996-149905018 AGTCCATGTGCAGCACCCAGAGG - Intergenic
1017818685 6:158033299-158033321 AGCCCAAGTGCAGAGTCCACTGG + Intronic
1017914376 6:158819679-158819701 GGGCCAGGTGCAGCCGCCCCAGG - Intergenic
1018447065 6:163867588-163867610 AGACGACGTGCAGCTTCCACCGG + Intergenic
1018634668 6:165850198-165850220 AGTCCAGGTGGCGGCTCCATGGG - Intronic
1019266633 7:120839-120861 AGTCCAGGAGCAGAGTCCAGAGG - Intergenic
1019409619 7:900831-900853 AGGGCAGGTGCAGCCTCCCCCGG + Intronic
1020026203 7:4901788-4901810 AAGCCAGGTGCAGGCTCCCCCGG - Intergenic
1021923903 7:25516044-25516066 AATCCAGGAGCAGCCCCAACAGG + Intergenic
1023052611 7:36266377-36266399 AGTCTAGAGGCAGCCTCCCCAGG + Intronic
1024771294 7:52726277-52726299 AGCCCCGCTGCAGCCTCCCCAGG - Intergenic
1026032775 7:66808654-66808676 TGTCTGGGTGCAGCCTCCCCAGG - Intronic
1026512417 7:71038018-71038040 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1030366948 7:108657187-108657209 AGCCCCAGTGCAGCATCCACTGG - Intergenic
1030780489 7:113593741-113593763 AGTCCCGGTGCGGGATCCACTGG + Intergenic
1033180628 7:139174354-139174376 AGTCCAGAGGCCTCCTCCACTGG + Intronic
1035002607 7:155625697-155625719 AGAGCAGGTGCAGACTTCACAGG + Intronic
1035056295 7:156038943-156038965 GGTCCAGGTGCAGACAACACTGG - Intergenic
1035352288 7:158255314-158255336 AGGCCTGGTTCAGCCTCCAGGGG + Intronic
1035663181 8:1362454-1362476 GGTCCATGTGCAGCCTCCGGCGG + Intergenic
1036699653 8:11003876-11003898 AGTCCAGGTGAACCGTCCAGAGG + Intronic
1036915051 8:12796686-12796708 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1037628230 8:20627467-20627489 AGTCCAGGAACGCCCTCCACTGG - Intergenic
1039393522 8:37202594-37202616 AGTTCAGCAGCAGCCCCCACGGG - Intergenic
1042665739 8:71203561-71203583 AGTCCAGCCCCATCCTCCACAGG - Intronic
1043701193 8:83290773-83290795 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1044075896 8:87821257-87821279 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1044404958 8:91816744-91816766 AGCCCAGGTGCGGGATCCACTGG + Intergenic
1048365331 8:133733314-133733336 ACTGCAGATGCAGCCTCCCCAGG + Intergenic
1049326529 8:142024327-142024349 AGGACAGGTGCAGCCTCGCCTGG - Intergenic
1051742216 9:20263062-20263084 AGCACAGGTGCAGGCTCCAGTGG - Intergenic
1052957286 9:34263226-34263248 AGACCTGATGCCGCCTCCACAGG + Intronic
1053503410 9:38620895-38620917 TGTCCCGGTGCAGCCGCCGCCGG + Intergenic
1055486690 9:76763166-76763188 AGCCCAGGTGCTGCCTGCACTGG + Intronic
1055747070 9:79459815-79459837 CTTCCAGGTGTAGCTTCCACTGG - Intergenic
1056451229 9:86718672-86718694 AATCCAGGTGAAATCTCCACGGG - Intergenic
1056958340 9:91100753-91100775 AGACCAGTTGCTGCATCCACTGG - Intergenic
1058148670 9:101440408-101440430 AGTCCAGGAGCAACAGCCACTGG + Intergenic
1058174796 9:101724053-101724075 AGCCCCGGTGCAGGATCCACTGG - Intronic
1060212977 9:121721819-121721841 TGTCCAGGTGCCCCCTCCCCAGG - Intronic
1060342498 9:122789644-122789666 AGTCGGCGAGCAGCCTCCACCGG + Exonic
1061888487 9:133605449-133605471 AGTCCCTGCCCAGCCTCCACCGG + Intergenic
1062161494 9:135082844-135082866 AGGCCAAGTCCAGGCTCCACAGG + Intronic
1062345003 9:136110498-136110520 CCCCCATGTGCAGCCTCCACAGG - Intergenic
1190045797 X:47110942-47110964 AGCCCAGGTGCGGGATCCACTGG - Intergenic
1190413895 X:50163270-50163292 AGCCCCGGTGCAGGATCCACTGG - Intergenic
1191736723 X:64395399-64395421 ACTCCAGATGCCGCCGCCACCGG + Exonic
1192041272 X:67624407-67624429 AGCCCAGGTTCAGTCTTCACTGG + Intronic
1192849818 X:74942873-74942895 ACTGCAAGTGCAGCCTCTACTGG + Intergenic
1196775577 X:119334017-119334039 AGTCCCGGTGCAGAATCCAGTGG + Intergenic
1198300056 X:135325876-135325898 AGCCCCGGTGCAGGATCCACTGG + Intronic
1199831727 X:151555130-151555152 AGCCCCGGTGCAGGATCCACTGG - Intergenic
1200214986 X:154364243-154364265 AGTCCAGGTAGAGCACCCACGGG - Exonic
1201430557 Y:13897579-13897601 GGTCCTGGTGCAGGATCCACTGG + Intergenic