ID: 1132376877

View in Genome Browser
Species Human (GRCh38)
Location 15:101334015-101334037
Sequence AGGGCCTTGCTTACCTCTTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132376877_1132376884 21 Left 1132376877 15:101334015-101334037 CCGGAAGAGGTAAGCAAGGCCCT 0: 1
1: 0
2: 0
3: 16
4: 167
Right 1132376884 15:101334059-101334081 AGCATAGCATTTCTAGCACACGG 0: 1
1: 0
2: 1
3: 12
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132376877 Original CRISPR AGGGCCTTGCTTACCTCTTC CGG (reversed) Intronic
900318738 1:2072168-2072190 AGGGCCAAGCTTCCCTCGTCAGG - Intronic
902638217 1:17749105-17749127 TGGGTCTTGGTTACCTCTTCTGG - Intergenic
903027739 1:20441764-20441786 AGGGCCTTGCTGAACTCTACAGG + Intergenic
910412938 1:86965427-86965449 AGTTCCTTGCTGCCCTCTTCTGG + Intronic
912963403 1:114216027-114216049 AGGACCTTGTTTATCTTTTCAGG + Intergenic
919083111 1:192890328-192890350 AGAGCCTTGGTTTCCTCATCTGG - Intergenic
920079813 1:203364692-203364714 TGGGTCTTGCTTACCCCTGCTGG + Intergenic
922981224 1:229828636-229828658 AGAGGCTTCCTTACCTCATCTGG + Intergenic
923249840 1:232169589-232169611 AGGGCCTTGCGGTCCTCTTCTGG + Intergenic
1063559672 10:7114420-7114442 GGCGCTTTGCTCACCTCTTCCGG + Intergenic
1063798774 10:9546069-9546091 AGGACCTTGCATCCCTCTTGCGG - Intergenic
1064007055 10:11707214-11707236 AGGGCCTTCCTTCCCTGATCTGG + Intergenic
1070773057 10:79093768-79093790 ATGCCCTTGCGTGCCTCTTCAGG + Intronic
1070816791 10:79329355-79329377 AGGGCCAGGCCTACCTCTCCTGG - Intergenic
1071345128 10:84685088-84685110 AGGGCCTTGCCTTGCTCTGCAGG + Intergenic
1075651309 10:124129616-124129638 CTGGCCTTGGTTTCCTCTTCTGG + Intergenic
1076589086 10:131570865-131570887 CTGGCCTGGCTTCCCTCTTCAGG - Intergenic
1079776462 11:24536413-24536435 ATGGTCTTGCTTAGATCTTCTGG + Intronic
1081585715 11:44382367-44382389 AGAGCCTGGCTTTCCTCTCCAGG - Intergenic
1081601943 11:44501383-44501405 AGGGCCTGGCTTACCTCCCAAGG - Intergenic
1083303945 11:61753206-61753228 AGGACCTTCCGTACCTCTTGAGG + Intronic
1084537045 11:69763462-69763484 TGGTCCTTCCTTGCCTCTTCTGG - Intergenic
1084872044 11:72105004-72105026 AGGGCCCTGCTTACCTGGGCTGG - Exonic
1087235695 11:95716070-95716092 AGTGGCTTGCTGACCTATTCAGG + Intergenic
1089014053 11:115152535-115152557 AGGGCCTTGCTTAGTTGCTCAGG - Intergenic
1090407127 11:126483175-126483197 AAGGCCTTGCTAAGTTCTTCTGG + Intronic
1090429868 11:126636714-126636736 AGGGCCTAGCTTAGCCCATCAGG - Intronic
1091342235 11:134824792-134824814 AGGGTATTCCTCACCTCTTCTGG - Intergenic
1091979909 12:4856386-4856408 AGGGCCTTGGTTTCCCCCTCTGG + Intergenic
1093471617 12:19508016-19508038 AGGATTTTGCTGACCTCTTCTGG - Intronic
1094553465 12:31474230-31474252 TGGGCCTTGCTTACCTCCTTTGG - Intronic
1097394321 12:59055001-59055023 AGGGCCTTGCTCCCCTCTGAAGG - Intergenic
1097581356 12:61460716-61460738 AGGGTCTTCTTTTCCTCTTCCGG - Intergenic
1100739277 12:97573290-97573312 TGGGCCCTGTTTACCTCTTCAGG + Intergenic
1100880091 12:99006867-99006889 AGTGCCTTGCTTTCCTCATATGG - Intronic
1101654196 12:106705637-106705659 AGGCCCTTGCTTACCTCACCAGG - Intronic
1101673661 12:106898764-106898786 AGGGCCTTTGTTGCCTCTTTGGG - Intergenic
1102093696 12:110217392-110217414 AGTGCCTTGCTTACCACTAGAGG + Intronic
1103727866 12:123007684-123007706 AGAGCCTTGGTTACCTTTTCTGG + Intronic
1104126299 12:125849283-125849305 AAGGCCATCCTTACCACTTCAGG + Intergenic
1104271215 12:127284172-127284194 TGGGCCTTGCTTAAATCTTCAGG + Intergenic
1105202851 13:18194579-18194601 GGGGCCGTGCTGACCTCTCCCGG - Intergenic
1105488807 13:20866047-20866069 AGGGATTGGCTTACTTCTTCTGG - Intronic
1106936679 13:34730114-34730136 GGGGCTTGGCTTATCTCTTCGGG - Intergenic
1107146464 13:37066062-37066084 GGAGCCTTGCTTTCCTCCTCTGG + Intergenic
1108075056 13:46671036-46671058 AGGCCCCTGCTCACCTCTTCGGG + Intronic
1108301837 13:49085373-49085395 AGGGCTTTGCTTATGTCTTATGG - Intronic
1108385272 13:49893893-49893915 AGGGCCTTGCTGACCTTGGCAGG - Intergenic
1108590347 13:51907302-51907324 AGGGCCTTGCTGACCTTGGCAGG + Intergenic
1109127184 13:58531898-58531920 AGGGCCTTGCTGACCTTGGCAGG - Intergenic
1110315847 13:74105533-74105555 ATGCCCTTGCTTACCTTTTCAGG - Intronic
1113302437 13:109036910-109036932 AGGGCCTTGCTCATCTTTTTTGG - Intronic
1119679984 14:76585028-76585050 AGAGCCCTGCTTGTCTCTTCAGG + Intergenic
1119858429 14:77918612-77918634 GGGGGCTGGCTTCCCTCTTCTGG + Intronic
1121139386 14:91527801-91527823 AAGGCCATGCATACCTGTTCTGG - Intergenic
1121690250 14:95873165-95873187 ATGGCCTTGCCTGCTTCTTCAGG + Intergenic
1124653248 15:31487988-31488010 AGGGTGTTGCTGACCTCTACTGG + Intronic
1124693457 15:31844868-31844890 AGGGCCCTGCTTACTGCCTCGGG + Intronic
1126506935 15:49416039-49416061 TGGTCCCTGCCTACCTCTTCAGG + Intronic
1128326563 15:66727622-66727644 AGGGCCTTGAATGCCACTTCAGG + Intronic
1128615122 15:69102917-69102939 CAGGCCCTGCTTCCCTCTTCAGG + Intergenic
1132376877 15:101334015-101334037 AGGGCCTTGCTTACCTCTTCCGG - Intronic
1133034642 16:3028050-3028072 AGGGGCTCACTTTCCTCTTCAGG - Exonic
1133142626 16:3758942-3758964 AGGGCCTGGCGTAACTCCTCTGG + Exonic
1133392503 16:5421532-5421554 AGGGCTTCCCTTACCTCCTCAGG - Intergenic
1134389219 16:13803688-13803710 GGGGACTTGATTGCCTCTTCAGG - Intergenic
1134895802 16:17885930-17885952 AGGGCCTTGCTGACCTCAGAAGG + Intergenic
1136036982 16:27548034-27548056 AGGGCCTCGATTTTCTCTTCAGG + Intronic
1138713642 16:58997379-58997401 ACAGCCTGGCTTTCCTCTTCTGG - Intergenic
1140482324 16:75268173-75268195 AGGGCCTCGCTTAGCTCTCAAGG - Intergenic
1141649682 16:85386207-85386229 AGGGCCTTGTTCAGCTCTGCTGG - Intergenic
1142483281 17:231399-231421 AGGGCCCTGCTGCCCACTTCTGG + Intronic
1143054802 17:4154852-4154874 GGGAGCCTGCTTACCTCTTCTGG - Exonic
1143365429 17:6405442-6405464 AGAGCCTTGGTTTCCTCATCTGG + Intronic
1143955405 17:10664310-10664332 CGTGCCTTGGTTTCCTCTTCTGG - Intergenic
1144195169 17:12887251-12887273 AGGGCCTTGCTCTGCTCTCCAGG + Intronic
1144838727 17:18172436-18172458 TGAGCCTTGCTTTCCTCATCTGG + Intronic
1145868539 17:28255988-28256010 ATGGCCTGGCTCACCTCCTCGGG + Intergenic
1148052909 17:44777912-44777934 AGGCCCCTGCTCACCTCTCCTGG + Intronic
1148766782 17:50044150-50044172 TGGGCCTTTGTTTCCTCTTCTGG + Intergenic
1149563945 17:57628564-57628586 AGGGCCTTACTTCTCTCTTTTGG + Intronic
1150210025 17:63436742-63436764 CTGGCCTTGCCCACCTCTTCTGG - Intronic
1151535250 17:74735711-74735733 AGAGCTTGGGTTACCTCTTCTGG - Intronic
1155423566 18:25682230-25682252 TGGTCCTTGCTTCCCTATTCAGG + Intergenic
1155435683 18:25810549-25810571 AGGGCCTTTCTTATTTCTACTGG + Intergenic
1156497512 18:37535853-37535875 AGGACCTTGCTAACCTTTCCTGG + Intronic
1158684933 18:59605021-59605043 AGGGCATTGCTTTAATCTTCAGG - Intronic
1159797207 18:72859102-72859124 AGGTCATTTCTTACATCTTCAGG + Intronic
1162927831 19:13938884-13938906 AGGGCCTTGGTTTCCCTTTCTGG + Intronic
1163795154 19:19333748-19333770 GTCGCCTTGCTTACCTCTGCTGG + Intronic
1164840787 19:31390670-31390692 GAGGCCTTCCTTACCTTTTCTGG + Intergenic
1165391870 19:35543563-35543585 AGGCCCCTGCTTTCCTCTTAAGG - Intronic
926888648 2:17620226-17620248 AGGGCCTGGCTCACGTCTCCAGG - Intronic
929029100 2:37634364-37634386 AGGGCCTTGTATACCTGTTTAGG + Intergenic
935800657 2:106691861-106691883 AGGGATTTGGTTACTTCTTCCGG + Intergenic
936109567 2:109653832-109653854 AGGGCCTTTTCTAGCTCTTCAGG + Intergenic
936267941 2:111024475-111024497 AGGTTCTTTCTTTCCTCTTCTGG - Intronic
937062282 2:118989558-118989580 AGGGGCTGGCAGACCTCTTCAGG - Intronic
937090864 2:119205389-119205411 AAGGCCTTGCTATCCTCCTCTGG - Intergenic
938068016 2:128292336-128292358 AGGGCCCACCTTACCTCCTCAGG - Intronic
948517365 2:238512129-238512151 AGGGTCCTGCTTGCCTCTTCTGG - Intergenic
1171020738 20:21582096-21582118 AGGCCCCTGCCCACCTCTTCAGG + Intergenic
1172012162 20:31851814-31851836 AAGGGCATGCCTACCTCTTCAGG + Intronic
1174447707 20:50601912-50601934 TGGGCCTTGGTTTCCTCATCTGG - Intronic
1174716712 20:52766603-52766625 AGGGCATGGCTAACCTCTTTAGG - Intergenic
1176715105 21:10343426-10343448 GGGGCCGTGCTGACCTCTCCCGG + Intergenic
1178817720 21:35946695-35946717 AGGGGCTTCCTTGCCTGTTCAGG - Intronic
1178953793 21:37006294-37006316 CGGGCCTCGCTTTCCTCTCCCGG + Intronic
1179026353 21:37682264-37682286 AGGTCCTTTCTTGCTTCTTCTGG + Intronic
1179333084 21:40424492-40424514 AGGTCCTTGCTCACCTCCTGCGG - Intronic
1180603242 22:17036512-17036534 GGGGCCGTGCTGACCTCTCCCGG - Intergenic
1181277569 22:21696229-21696251 AGGGCCCTGCTCACCTGCTCTGG + Intronic
1183015494 22:34983220-34983242 AGGGCCTTGGTCACCTTCTCTGG + Intergenic
1183265298 22:36821221-36821243 AGGGTTTTGCCTACCTCTTAAGG - Intergenic
950848270 3:16035726-16035748 AAGTCCTTCCTTCCCTCTTCAGG + Intergenic
952166364 3:30753914-30753936 AGGCAATTGCTTCCCTCTTCTGG - Intronic
953204589 3:40813166-40813188 AGGTTCTTGCTTACCTCAACTGG + Intergenic
953366326 3:42348482-42348504 AGGGCCCTGCCAACCTCCTCTGG - Intergenic
953481615 3:43256956-43256978 GTGGCCTTGCTGACCTCTTCAGG - Intergenic
954079555 3:48205488-48205510 AGGGCCTCAGTTACCCCTTCTGG + Intergenic
954656380 3:52196786-52196808 TGGGCCTTGCTTTCCTTATCTGG - Intergenic
954886453 3:53878796-53878818 AGGGTCTTGCTCTCTTCTTCAGG - Intronic
955485005 3:59426366-59426388 AGGCCATTTCTTACCTTTTCTGG + Intergenic
955649882 3:61182693-61182715 AGGGCCCTGCCTACCTCTTTTGG - Intronic
955965054 3:64380536-64380558 TGGGCCTTGCTGGACTCTTCTGG - Intronic
957582319 3:82090164-82090186 AGGGCCGTGCTCACCCCTTATGG + Intergenic
959551885 3:107669379-107669401 TGGGCCTTGAATACATCTTCTGG + Intronic
960199610 3:114814936-114814958 AGGGCCTTTCTTATCTCATATGG - Intronic
960265439 3:115615846-115615868 AGAGACTTGCTCACCTCCTCTGG - Intergenic
960268021 3:115643601-115643623 AGTAGCTTCCTTACCTCTTCAGG + Intronic
960466037 3:117997417-117997439 ACAGCCTTGCTCTCCTCTTCGGG + Intergenic
960902102 3:122563837-122563859 AGGGCCTTGCTCTGCTCTTTGGG + Intronic
962292778 3:134150645-134150667 AGGGTCCTTCTCACCTCTTCTGG - Intronic
969502876 4:7564293-7564315 AGGTCCTTCCTTGCCTCTCCTGG + Intronic
975013031 4:69378927-69378949 AGGGCCTTCCTTAGCCTTTCTGG - Intronic
977272149 4:94930269-94930291 ATGGCATTGCTTAGATCTTCTGG + Intronic
977795108 4:101155378-101155400 AATGCCTACCTTACCTCTTCAGG - Intronic
978924438 4:114226150-114226172 AGGGCCTGGCTCACTTGTTCAGG - Intergenic
984519522 4:180785224-180785246 AGGGCCCTCTTTACCTCCTCTGG + Intergenic
984929970 4:184838345-184838367 AGGGTCTTGCTTTCTTGTTCAGG + Intergenic
985419718 4:189772722-189772744 AGTGCTCTGCTTACCTTTTCAGG - Intergenic
985881170 5:2640317-2640339 AGGGCAGTCCTTACCTTTTCGGG - Intergenic
996318871 5:122191720-122191742 AGGGTCTTGCTCAGCTGTTCAGG - Intergenic
999582822 5:153058617-153058639 AGTGCCTTGGTTGCCTCATCTGG + Intergenic
999962542 5:156772318-156772340 AGGTCCTTGTTTACCTCATTAGG - Intergenic
1007230222 6:40343060-40343082 AGGGCTTTGCTCTCCTCTTCTGG - Intergenic
1014266772 6:119286962-119286984 AGGGCCTCGATTTCCTGTTCAGG + Intronic
1016907094 6:149161774-149161796 AGGACATTGCTTTCCTCCTCTGG + Intergenic
1019018164 6:168895716-168895738 AGGGCCTGCCTTACATCTGCCGG + Intergenic
1019093108 6:169556313-169556335 AGGGCCTTGGTTACCTTCTGAGG - Intronic
1019603465 7:1896657-1896679 AGTGGCTTGCTTCCCTCTTTTGG + Intronic
1019840131 7:3433430-3433452 GGAACCTTCCTTACCTCTTCTGG - Intronic
1021395929 7:20148141-20148163 AGGCCCTTGCTTTCCCCTTCTGG + Intronic
1022219834 7:28302641-28302663 ATGGCCTTGCCTGCCTCTTTTGG - Intronic
1022887943 7:34665590-34665612 AGGGTCCTGTTTACCTTTTCTGG + Intronic
1023487015 7:40698293-40698315 CTGGCCCTGCCTACCTCTTCTGG - Intronic
1024354786 7:48403344-48403366 AGGGCCCTGCATCCCTCTACAGG - Intronic
1026428951 7:70324971-70324993 TGGGCCTCACTTTCCTCTTCAGG - Intronic
1026619314 7:71936430-71936452 AGAGCCTTGCTTCACTCCTCTGG + Intronic
1028617431 7:92784463-92784485 AGGGCACTGTTTACCTCTTGAGG + Intronic
1028863319 7:95679279-95679301 ATGCCCTTCCTTACCTGTTCAGG + Intergenic
1029003934 7:97187175-97187197 AGAGCCTTGCATACTTCTGCCGG + Intergenic
1029303580 7:99602573-99602595 AGGACCTTGCTTTCCCCATCTGG - Intronic
1029490688 7:100868455-100868477 GGGTCCTTGCTTACGACTTCTGG + Intronic
1032096485 7:128940761-128940783 AGGGCCGGCCTTACCTCTCCTGG + Intronic
1032387512 7:131534605-131534627 TGGGCCTGGCTTTCCTCCTCAGG + Intronic
1033614628 7:143002293-143002315 ATGTCTTTGCTGACCTCTTCTGG + Intergenic
1034383945 7:150722412-150722434 AGGGCCTTGGTGACCGCTGCAGG + Exonic
1037758460 8:21726543-21726565 GGGCCCTTCCTTGCCTCTTCCGG + Intronic
1038577968 8:28721666-28721688 AGGGGCTTACTGAACTCTTCTGG + Intronic
1040661939 8:49583877-49583899 AGGGCTGTGATTACCTCTTTGGG + Intergenic
1042126034 8:65538025-65538047 GGAGCCTTGCTTCCCTCTGCGGG - Intergenic
1049960255 9:731412-731434 TGGGCTTTGCTTTCCTCCTCTGG + Intronic
1052871504 9:33511816-33511838 AGGGCCTTGATCACCTGTACAGG + Intergenic
1054818140 9:69495633-69495655 AGGGGCTGGCCTACCCCTTCTGG + Intronic
1058946396 9:109861040-109861062 AGGGCCTTGAGTAGGTCTTCTGG + Intronic
1059443449 9:114323848-114323870 AGGGACTTGCTCAGGTCTTCTGG - Intronic
1059444640 9:114330619-114330641 AGGGACTTGCTCAGGTCTTCTGG - Intronic
1061448614 9:130656346-130656368 CCGGCCTTGCCTACCTCCTCTGG - Intergenic
1062104446 9:134745839-134745861 AGGGTCTTCCTCACCTCTTCTGG + Intronic
1062525081 9:136974926-136974948 ATGGCCTTGGTGACCTCTTAGGG + Intergenic
1194240624 X:91442591-91442613 AGGGTATTGCTAACCTTTTCTGG + Intergenic
1200110855 X:153740229-153740251 ACGGGCTTCCTTACCTCTGCGGG - Exonic
1201680985 Y:16643414-16643436 AGGGGATGGCTTTCCTCTTCAGG + Intergenic