ID: 1132381960

View in Genome Browser
Species Human (GRCh38)
Location 15:101372241-101372263
Sequence CCCCGTAATAAGCCAAGCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 60}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132381960_1132381969 24 Left 1132381960 15:101372241-101372263 CCGGTGCTTGGCTTATTACGGGG 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1132381969 15:101372288-101372310 CTCTCCTCCCGGGAGGCATGAGG 0: 1
1: 0
2: 4
3: 14
4: 250
1132381960_1132381962 0 Left 1132381960 15:101372241-101372263 CCGGTGCTTGGCTTATTACGGGG 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1132381962 15:101372264-101372286 AGCGCTTTTCCCATTATGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 73
1132381960_1132381967 17 Left 1132381960 15:101372241-101372263 CCGGTGCTTGGCTTATTACGGGG 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1132381967 15:101372281-101372303 GCCTGGACTCTCCTCCCGGGAGG 0: 1
1: 0
2: 4
3: 18
4: 192
1132381960_1132381966 14 Left 1132381960 15:101372241-101372263 CCGGTGCTTGGCTTATTACGGGG 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1132381966 15:101372278-101372300 TATGCCTGGACTCTCCTCCCGGG 0: 1
1: 0
2: 3
3: 16
4: 205
1132381960_1132381965 13 Left 1132381960 15:101372241-101372263 CCGGTGCTTGGCTTATTACGGGG 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1132381965 15:101372277-101372299 TTATGCCTGGACTCTCCTCCCGG 0: 1
1: 0
2: 0
3: 14
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132381960 Original CRISPR CCCCGTAATAAGCCAAGCAC CGG (reversed) Intronic
902244238 1:15108905-15108927 CCAGGGCATAAGCCAAGCACAGG - Intronic
902695904 1:18140734-18140756 CCCCCTGCCAAGCCAAGCACAGG - Intronic
905851495 1:41278147-41278169 GCCCGTGATATGCCAGGCACTGG - Intergenic
906286540 1:44591558-44591580 CACCCTAATAAGCCAGGGACTGG - Intronic
907562883 1:55407029-55407051 CCCAGTCCTAAGCCAAGAACAGG - Intergenic
1068590596 10:58849038-58849060 CCCCATAAAAAGAAAAGCACAGG - Intergenic
1071451771 10:85799601-85799623 AACCCAAATAAGCCAAGCACAGG + Intronic
1072286009 10:93915752-93915774 CCCCTTTCTAAGCCAATCACTGG - Intronic
1074959366 10:118426738-118426760 AACTGGAATAAGCCAAGCACTGG - Intergenic
1075308950 10:121395181-121395203 CCCTGGAATGAGCCAAGCTCTGG + Intergenic
1075631884 10:124005359-124005381 GCCCGTATTCGGCCAAGCACAGG - Intergenic
1083307842 11:61770132-61770154 CCCCGTCCTGAGCCAAGCCCGGG - Intronic
1084720216 11:70900779-70900801 ACCCATGATAAGCCAAGCATAGG - Intronic
1084961886 11:72721204-72721226 GTCCCCAATAAGCCAAGCACAGG + Intronic
1086085074 11:82945532-82945554 CCCCGTACTCAGCCAGGCTCAGG - Intronic
1088388649 11:109289458-109289480 CCCCCCAAAAAGCCAAGGACTGG + Intergenic
1106514162 13:30438636-30438658 CCCAGGAATGAGCCAAGCGCAGG - Intergenic
1106574061 13:30957790-30957812 ACCTGTGATAAGCCAGGCACTGG - Intronic
1122800515 14:104227141-104227163 CCCCTTAATAACACAGGCACAGG - Intergenic
1128535960 15:68490684-68490706 CAGTGAAATAAGCCAAGCACTGG - Intergenic
1132381960 15:101372241-101372263 CCCCGTAATAAGCCAAGCACCGG - Intronic
1135986860 16:27190287-27190309 TCCCGCAATATGGCAAGCACGGG - Intergenic
927503602 2:23598723-23598745 CCCAGTCATAAGCAAAACACAGG - Intronic
935124668 2:100212966-100212988 CCAGGTGATAAGCCCAGCACAGG + Intergenic
948005169 2:234602401-234602423 ACCTGTAATAAGCAAAGCAAAGG - Intergenic
948901702 2:240959632-240959654 CCACGCACTAAGCCAAGCCCAGG + Intronic
949050232 2:241894060-241894082 CCCCGTAATAATCCCACCTCGGG - Exonic
1169067882 20:2704803-2704825 CCCAGTGATACACCAAGCACTGG - Intronic
1175978678 20:62726232-62726254 CCCAGTTAAAACCCAAGCACAGG + Intronic
1179487930 21:41722682-41722704 CCCCATATCCAGCCAAGCACTGG - Intergenic
1181003533 22:19998993-19999015 CCCTGGAATAAGCCAAGCCATGG - Intronic
1181791374 22:25269561-25269583 CCCCGTAAAAAACCCAGCCCAGG - Intergenic
1185234477 22:49704224-49704246 CCCCGTAGCAGGCCAGGCACTGG - Intergenic
954089982 3:48276612-48276634 CCCCGCCATAAGCAAGGCACGGG - Intronic
967237874 3:187405306-187405328 CCACGTAATACACCATGCACTGG + Intergenic
969163573 4:5283179-5283201 CAGCGAAATAAGCCAGGCACAGG - Intronic
969662062 4:8536178-8536200 ACCCTCAACAAGCCAAGCACAGG - Intergenic
972143100 4:35985882-35985904 ACCTGAAATAAGCCAGGCACAGG + Intronic
975621197 4:76298625-76298647 ACGTGAAATAAGCCAAGCACAGG + Intronic
976008235 4:80456409-80456431 CTTTGTAATAAGCCAAGCAAGGG + Intronic
982066873 4:151662144-151662166 CCCCTTAATAAGCCAATGACAGG + Intronic
984549610 4:181144902-181144924 CACAGCATTAAGCCAAGCACAGG - Intergenic
985133040 4:186758240-186758262 CACGGTAATAAGCCAACCCCAGG - Intergenic
987557810 5:19478157-19478179 CCACTTAGTATGCCAAGCACTGG - Intronic
988522310 5:31957390-31957412 CCCCGTAACACCCCAGGCACTGG - Intronic
994023223 5:95051927-95051949 CCCAGTAATAAGCATAGTACTGG - Intronic
998377593 5:141701592-141701614 CTCAGTAATAATCCCAGCACAGG + Intergenic
1003654893 6:7997785-7997807 CCCTGTAATTAGCCAAGTACTGG + Intronic
1008410636 6:51174586-51174608 CCCTGTGGTATGCCAAGCACTGG + Intergenic
1018943167 6:168324057-168324079 CCGGGTAATAAGCATAGCACTGG + Intergenic
1027508725 7:79052384-79052406 CACAGCATTAAGCCAAGCACAGG + Intronic
1030921741 7:115397974-115397996 TCAAGTAATAATCCAAGCACAGG - Intergenic
1035576507 8:710413-710435 CCCCGTACGATGCCAAGGACTGG - Intronic
1036766748 8:11554261-11554283 CACCGTAATAAGCTATGCCCAGG - Intronic
1047313934 8:123715226-123715248 CAGAGTATTAAGCCAAGCACAGG + Intronic
1047810087 8:128399066-128399088 CCCTGTACTCAGCCAAGCTCTGG - Intergenic
1050127494 9:2374097-2374119 CCAGGTACTAAGCCTAGCACTGG - Intergenic
1050312611 9:4368662-4368684 CCTCTTCTTAAGCCAAGCACTGG + Intergenic
1050524319 9:6532178-6532200 AGAGGTAATAAGCCAAGCACTGG - Intergenic
1189317380 X:40065534-40065556 GCCCGTGATAGGCCGAGCACAGG - Intronic
1192175836 X:68884911-68884933 TCCCTTTAGAAGCCAAGCACAGG + Intergenic
1194111597 X:89840625-89840647 CCCTTTAATATGACAAGCACAGG + Intergenic
1200464262 Y:3495429-3495451 CCCTTTAATATGACAAGCACAGG + Intergenic