ID: 1132383323

View in Genome Browser
Species Human (GRCh38)
Location 15:101381846-101381868
Sequence AGCAGATTGCTCCACGATAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 45}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132383323_1132383329 -7 Left 1132383323 15:101381846-101381868 CCCCTATCGTGGAGCAATCTGCT 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1132383329 15:101381862-101381884 ATCTGCTACAAAAGGGGAAGAGG 0: 1
1: 0
2: 1
3: 14
4: 205
1132383323_1132383331 10 Left 1132383323 15:101381846-101381868 CCCCTATCGTGGAGCAATCTGCT 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1132383331 15:101381879-101381901 AAGAGGCCTCAAAACAGTGGTGG 0: 1
1: 0
2: 4
3: 17
4: 258
1132383323_1132383330 7 Left 1132383323 15:101381846-101381868 CCCCTATCGTGGAGCAATCTGCT 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1132383330 15:101381876-101381898 GGGAAGAGGCCTCAAAACAGTGG 0: 1
1: 0
2: 1
3: 22
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132383323 Original CRISPR AGCAGATTGCTCCACGATAG GGG (reversed) Intronic