ID: 1132385720

View in Genome Browser
Species Human (GRCh38)
Location 15:101398577-101398599
Sequence CTGAAAGCACAGAGGAGGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 522
Summary {0: 1, 1: 1, 2: 5, 3: 51, 4: 464}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132385715_1132385720 -4 Left 1132385715 15:101398558-101398580 CCGTCCAGCATGCGGATGCCTGA 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1132385720 15:101398577-101398599 CTGAAAGCACAGAGGAGGCTCGG 0: 1
1: 1
2: 5
3: 51
4: 464
1132385712_1132385720 19 Left 1132385712 15:101398535-101398557 CCTCGACCACATCTGTGACATCG 0: 1
1: 0
2: 0
3: 4
4: 98
Right 1132385720 15:101398577-101398599 CTGAAAGCACAGAGGAGGCTCGG 0: 1
1: 1
2: 5
3: 51
4: 464
1132385716_1132385720 -8 Left 1132385716 15:101398562-101398584 CCAGCATGCGGATGCCTGAAAGC 0: 1
1: 0
2: 0
3: 6
4: 63
Right 1132385720 15:101398577-101398599 CTGAAAGCACAGAGGAGGCTCGG 0: 1
1: 1
2: 5
3: 51
4: 464
1132385713_1132385720 13 Left 1132385713 15:101398541-101398563 CCACATCTGTGACATCGCCGTCC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1132385720 15:101398577-101398599 CTGAAAGCACAGAGGAGGCTCGG 0: 1
1: 1
2: 5
3: 51
4: 464

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132385720 Original CRISPR CTGAAAGCACAGAGGAGGCT CGG Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
900994484 1:6113038-6113060 CAGAAAACACAGAGGACTCTGGG + Intronic
901501863 1:9657506-9657528 CGGAAAGCAGGAAGGAGGCTGGG - Intronic
901522725 1:9797703-9797725 CTGAAGGAACAGAGGAGGCTTGG + Intronic
901613268 1:10516557-10516579 ATGCCAGCACAGACGAGGCTTGG - Intronic
901834045 1:11912214-11912236 ATGAATGCACAGAGGTGGGTGGG - Intergenic
902110121 1:14071353-14071375 CTGAAGGAACAGAGGATTCTGGG + Intergenic
902399696 1:16151162-16151184 CTGAAGGCACACAGCAGGCTGGG + Intronic
902436044 1:16398580-16398602 CTGAGAGCCCAGTGGTGGCTGGG + Intronic
902653914 1:17854444-17854466 CTGGACACACAGAGGAGGCGGGG + Intergenic
902914481 1:19628368-19628390 TTTAAAGCAAATAGGAGGCTGGG - Exonic
902972276 1:20062496-20062518 CTGAAAACTCAGAGCAGGCTGGG + Intronic
903240299 1:21978306-21978328 CCAAAAGCAAAGAGGAGGCCAGG - Intronic
903244048 1:22002940-22002962 CCAAAAGCAAAGAGGAGGCCAGG - Intronic
903356192 1:22749313-22749335 CAGAAAGTAAAAAGGAGGCTGGG - Intronic
903510831 1:23873873-23873895 CTGGAAATACAGAGGAGGCTGGG - Exonic
904104080 1:28062703-28062725 TTAAAAGCACAGAATAGGCTGGG + Intronic
904572708 1:31478863-31478885 ATAAAATCACAGAGGAGGCTGGG + Intergenic
904825778 1:33272862-33272884 GTGAAAGCACAAGGCAGGCTTGG - Intronic
905173459 1:36122708-36122730 GGGAGATCACAGAGGAGGCTGGG - Intronic
905456971 1:38094965-38094987 CTGCATCCCCAGAGGAGGCTGGG + Intergenic
905481390 1:38264442-38264464 ATGAAGGCAAAGAGGGGGCTTGG - Intergenic
905484520 1:38285964-38285986 CTGACAGCACAGGGGAGGGGAGG + Intergenic
905750557 1:40459417-40459439 CTGAAAGAACAGGGGAGGTTAGG - Intronic
905959264 1:42030051-42030073 CAGAAAGCACAGGGCAGGGTCGG - Intronic
906478179 1:46183838-46183860 CAGAAAGGAAATAGGAGGCTGGG + Intronic
906513046 1:46422496-46422518 GTAAAAGCACAGACGAGGCCAGG - Intergenic
906521804 1:46471224-46471246 CTGAATGGAGAGAAGAGGCTGGG + Intergenic
906652637 1:47523691-47523713 CTGATAGGACAGTGGAGACTCGG - Intergenic
906701844 1:47865220-47865242 CTGCAAGCGGAGAGGAGGCCTGG - Intronic
907395139 1:54184456-54184478 CAGAAGGCAGACAGGAGGCTGGG + Intronic
908001273 1:59682719-59682741 CTCTAAGCTCAGAGGAGGGTGGG + Intronic
908326918 1:63031988-63032010 CTGAAAGCCAAGGGGAGGCATGG + Intergenic
908535388 1:65071990-65072012 CTTAAAACAAAGAGTAGGCTGGG + Intergenic
908649348 1:66314706-66314728 ATGAAAACACAGTGGAGGTTGGG - Intronic
910441755 1:87260223-87260245 TTGAAAGCTCAGAGGAAGCCAGG + Intergenic
910514636 1:88046526-88046548 CTGATAGCAGAAAGGAGGGTTGG - Intergenic
911878619 1:103203582-103203604 CCCAAAGCACAGAGGAGGGTAGG - Intergenic
912908639 1:113733962-113733984 CAGAAAGAAAAGAGGAGGCCGGG + Intronic
913161848 1:116152247-116152269 CTGAAGGCAGAGAGCAGACTGGG + Intergenic
914686356 1:149983148-149983170 TTAAAAGTACAGAGGAGGCCGGG - Intronic
916341508 1:163741432-163741454 CTGAAAAAACAGAGGAGGAGGGG - Intergenic
917051507 1:170929970-170929992 ATGAGAACACGGAGGAGGCTTGG + Intergenic
918785751 1:188760702-188760724 CTGAAAGTTCCCAGGAGGCTTGG + Intergenic
919938662 1:202271509-202271531 CAGAAAATACAGGGGAGGCTGGG + Intronic
920343837 1:205293130-205293152 TTAACAGCACAGAGGTGGCTGGG - Intergenic
920496317 1:206457402-206457424 CTGAAGGTACAGAGGAGGGAGGG + Intronic
920673311 1:208021361-208021383 ATGAAAGTACAGAGGAGGGGAGG + Intergenic
920959953 1:210655247-210655269 CAGAAAGCATGGAGGAGGCAGGG + Intronic
921065905 1:211621724-211621746 TGGCAAGCACAGAGGAGGCTTGG - Intergenic
921670334 1:217917654-217917676 CTGAAAGGACAGCGGAGCCCTGG + Intergenic
921961471 1:221039402-221039424 ATGAAAGAACAGAGGAGGGGAGG + Intergenic
922173689 1:223178428-223178450 CTGTAAGCCAAGGGGAGGCTGGG + Intergenic
922650262 1:227331841-227331863 CTGAAAGAATAGATGTGGCTGGG - Intergenic
923640493 1:235754518-235754540 CTGAAAAGACAGGTGAGGCTGGG - Intronic
1062936603 10:1395196-1395218 CAGAAAGAACAGATTAGGCTTGG - Intronic
1063200118 10:3779718-3779740 CTGAAGACACTGATGAGGCTTGG - Intronic
1063497602 10:6524828-6524850 CTGGAAGCACAGAGGGAGGTGGG - Intronic
1063939620 10:11113774-11113796 CTGGCTGCACAGAGGAGACTAGG - Intronic
1064010220 10:11729775-11729797 CTGAAAGCACAGGGATGCCTGGG - Intergenic
1064222506 10:13454183-13454205 CTGAAAGGACATCGCAGGCTTGG + Intronic
1064320450 10:14299631-14299653 CCAAAAGGACAGAGGAGGCAAGG - Intronic
1064332508 10:14406908-14406930 TGAAAAGCACAGAGGAGGCCAGG - Intronic
1064394213 10:14968190-14968212 TTAAAAGTACATAGGAGGCTGGG + Intronic
1064967629 10:21030906-21030928 CTGAAAGATCAGAGCAGGCCTGG + Intronic
1067183888 10:44011021-44011043 CTGTGAGCTCAGAGGAGACTTGG + Intergenic
1067203766 10:44196477-44196499 CTGAAGGCAGAGAGGAGGAGAGG + Intergenic
1068222837 10:54064837-54064859 CTGAGAGCACAGAGATGCCTAGG + Intronic
1069853612 10:71426276-71426298 CTGAAAGTGCAGAGCAGACTTGG - Intronic
1070121075 10:73577967-73577989 CTGTGAGCAAAGTGGAGGCTTGG - Intronic
1070339896 10:75488365-75488387 CTGAAAGCTCAGAGTGTGCTTGG + Intronic
1070348172 10:75565777-75565799 ATTAAAGGACAGAGGAGGCTGGG + Intronic
1070643349 10:78184653-78184675 TTGAGAGGAGAGAGGAGGCTGGG + Intergenic
1071503073 10:86217163-86217185 CTAAAATCACAGGGGAGCCTGGG + Intronic
1071527157 10:86365472-86365494 ATGAAAGCGCAGAGGAGGAGGGG - Intronic
1071556656 10:86608680-86608702 GTTAAAACACTGAGGAGGCTCGG - Intergenic
1072084855 10:92068704-92068726 ATGAAAGAACAGAGGAGGACAGG + Intronic
1072236619 10:93459248-93459270 CTGTAACCAGAGAGGAGGATTGG - Intronic
1073030845 10:100524397-100524419 GGGAAAGCACAGAGGAGACAAGG + Intronic
1073070987 10:100793174-100793196 CTGAGAGCCCAGAGAAGGCTGGG + Intronic
1073249761 10:102114447-102114469 CTGCAAGCCCAGAGGAGTCCTGG + Intronic
1073568993 10:104560133-104560155 CAGCAAACACAGATGAGGCTGGG - Intergenic
1073883632 10:108011888-108011910 ATTAAGGGACAGAGGAGGCTAGG - Intergenic
1074519898 10:114209713-114209735 CTGAAGACAAAGGGGAGGCTGGG - Intronic
1074892028 10:117743711-117743733 CTGACAGCAGAGAGCATGCTGGG + Intergenic
1075046907 10:119153632-119153654 CTGTAAGTGCAGAGCAGGCTGGG + Intronic
1075411601 10:122232535-122232557 CTGAAATAAAAGAGGTGGCTTGG - Intronic
1076149250 10:128149771-128149793 CGGAGCCCACAGAGGAGGCTCGG + Intergenic
1076921049 10:133454810-133454832 CAGAAAGTGCAGAGGAGGTTAGG + Intergenic
1076984862 11:228107-228129 CTGTAGGAACAGAGTAGGCTGGG - Intronic
1077012864 11:386640-386662 CTCTCAGCAGAGAGGAGGCTGGG - Intergenic
1077197035 11:1286242-1286264 CTGAGTGCACAGGGGACGCTGGG + Intronic
1077527389 11:3075384-3075406 CTGAAAGCAGAGAGCTGGCGGGG + Intergenic
1078160119 11:8832805-8832827 GTGAAAGCCCACAGGAGGCGAGG + Intronic
1078359516 11:10657568-10657590 CAGAAAGGTCAGTGGAGGCTAGG - Intronic
1079392501 11:20034834-20034856 CTGAAAGATGAGAGGAGGCAGGG + Intronic
1080285488 11:30606534-30606556 ATGAACGCAAAGAGGAGGCAGGG - Intergenic
1080654766 11:34250147-34250169 CTAAGAGCACAGAGGAGGGAAGG + Intronic
1081392302 11:42543168-42543190 ATGGAAGCACAAATGAGGCTGGG - Intergenic
1083301373 11:61741136-61741158 AGGACAGGACAGAGGAGGCTGGG - Intronic
1083857275 11:65399504-65399526 CTGATGGCACAGAGAAGGGTGGG - Intronic
1083898028 11:65630015-65630037 CTGAGACCACAGAGCAGGCTGGG - Intronic
1083919684 11:65775595-65775617 CTGTAAGCACCCAGGAAGCTGGG - Intergenic
1084085813 11:66854712-66854734 CGGAGAGCTCAGAGGAGTCTGGG - Intronic
1084682881 11:70677372-70677394 CTTAAAGGATAGAGGAGACTCGG - Intronic
1084766399 11:71311791-71311813 CTGGAAGCACAGAGCAGGTGTGG - Intergenic
1084864248 11:72042561-72042583 GAGAAAGCAGAGAGGAGGCATGG + Intronic
1084911022 11:72389312-72389334 CTGATGGCACAGAGGAAGGTAGG + Intronic
1085560365 11:77467009-77467031 GTGAGAGCAGAGAGGAGGCAGGG - Intronic
1085674057 11:78498608-78498630 CTGAAATCAAAGTGGAAGCTGGG - Intronic
1086165815 11:83776483-83776505 CAGAAAGCACCGAAGAGGCTGGG - Intronic
1087180129 11:95133817-95133839 CTGAAGGTACAGATGAGGGTTGG + Intergenic
1088013482 11:105032477-105032499 CTGAAAGCAATGTAGAGGCTAGG - Intronic
1088763192 11:112951190-112951212 CAGAAAGCACAGAGGAAGAGTGG + Intergenic
1088857918 11:113773181-113773203 CTGGAAGCTCCGAGGAAGCTAGG - Intronic
1088905150 11:114149850-114149872 CTGGAACCACAAAGGAGGCCTGG - Intronic
1089362873 11:117902545-117902567 CTGAAGGCCCAGAGAAGGCAGGG + Intronic
1090495912 11:127211866-127211888 CTGAAAGGACAGAAGAGATTTGG - Intergenic
1091404773 12:202368-202390 CTGTAAACACAGTGAAGGCTGGG + Intronic
1091890433 12:4049692-4049714 CTGAGAGCTGAGAGGAGACTTGG - Intergenic
1092263947 12:6967320-6967342 CTGACAGCCCAGAGGAGGACTGG - Intronic
1094235676 12:28163126-28163148 ATGAAATAACAGAGGAGGCCAGG + Intronic
1095823792 12:46509896-46509918 CTCAAATCAGGGAGGAGGCTAGG - Intergenic
1095981805 12:47978437-47978459 CTGAGAGGACAGAAGAGGCTGGG - Intronic
1096397226 12:51275435-51275457 CTGAGAGCTCCGAGGAGGCAGGG - Intergenic
1096504609 12:52084855-52084877 CTGGAAGTAGAGAGGAGGCAAGG + Intergenic
1099319919 12:81133309-81133331 CACAATGAACAGAGGAGGCTTGG - Intronic
1100535472 12:95504918-95504940 CAGAAAGCACAGGGGACTCTGGG - Intronic
1100715584 12:97302004-97302026 CTGAAAGCCCAGAGGAGGCAGGG - Intergenic
1101319323 12:103659331-103659353 CCAAATGCAGAGAGGAGGCTGGG + Intronic
1102122166 12:110450146-110450168 CGGAAGGCAGAGAGGAAGCTGGG - Intronic
1102193249 12:111005230-111005252 CAGAAAGAGCAGAGGAGTCTGGG + Intergenic
1103103927 12:118205980-118206002 CTGTAACCACAAAGAAGGCTTGG - Intronic
1103558762 12:121781193-121781215 CTGAAAGCACAGAGCAGCGGGGG + Exonic
1103575716 12:121875823-121875845 CCAAAAGCACAGATGAGGCTGGG + Intergenic
1105566663 13:21555902-21555924 TTGAGAGCACAGTGGAAGCTTGG - Intronic
1106027755 13:25971495-25971517 CTGAAAGATCAGATGAGGGTAGG - Intronic
1106110556 13:26772863-26772885 CAGAAAGGAGAGAGGAAGCTGGG - Intergenic
1106192614 13:27466847-27466869 CTGAAAGCACAGCAAAGGCTGGG - Intergenic
1106259957 13:28057742-28057764 CTAAAAACACACAGGAGGCCGGG + Intronic
1106408450 13:29494527-29494549 CTGGCAGCACTGAGGAGGTTTGG + Intronic
1106479051 13:30123306-30123328 CTGAAAGGACACATGAGGATGGG + Intergenic
1106783072 13:33079302-33079324 TTAAAAACACAGAGCAGGCTGGG + Intergenic
1108039278 13:46324354-46324376 CTGATAGAAAAGAGGAGGCGGGG + Intergenic
1110186866 13:72685225-72685247 CAGAAAGCAAAGAGGAAGCGAGG - Intergenic
1110880239 13:80562838-80562860 CTGTAAGCATAGATCAGGCTGGG + Intergenic
1111733345 13:92104397-92104419 CTGAAAGCAAAGAGAATACTGGG - Intronic
1112259640 13:97866753-97866775 CTGAGACCACAGAGGCAGCTAGG + Intergenic
1112636126 13:101220045-101220067 GTGGAAGCACATGGGAGGCTTGG - Intronic
1112798724 13:103087093-103087115 CTGAAAGCTCAACGGGGGCTGGG - Intergenic
1113518830 13:110923807-110923829 TTGAAAGGACAGAGGAGGGATGG - Intergenic
1113591782 13:111506520-111506542 CTGACAGCACCTGGGAGGCTGGG + Intergenic
1114543609 14:23482505-23482527 CTGAAAGGACAGAGTGGGGTTGG + Intronic
1115331893 14:32206575-32206597 CTGAGAGCTCACAGGAGGCGTGG - Intergenic
1115410181 14:33065460-33065482 CTTAAAGCAGAGAGAGGGCTGGG + Intronic
1116625513 14:47257744-47257766 CAGGAAGAACAGAGGAGTCTGGG + Intronic
1117099597 14:52332991-52333013 TTGAAAACACAGAAGAGGCCGGG - Intergenic
1117777855 14:59200723-59200745 CAGACAGAACAGAAGAGGCTTGG - Intronic
1118375005 14:65169227-65169249 CTTTAGCCACAGAGGAGGCTGGG - Intergenic
1119362023 14:74058787-74058809 CAAAAAGCATAGAGGCGGCTGGG + Exonic
1119597237 14:75946590-75946612 CTGAACACACAGAAGATGCTTGG - Intronic
1119632808 14:76248741-76248763 CTGGAAGCAGAGAGGACTCTGGG + Intronic
1119632901 14:76249410-76249432 CAGGAAGCACAAAGGTGGCTGGG - Intronic
1119675609 14:76551275-76551297 TTGAGAGCACAGAGGAGGGAGGG - Intergenic
1120244361 14:81989097-81989119 CTGAAAGCTCAGATGATGGTCGG + Intergenic
1121097705 14:91229362-91229384 CTCAAAGCACAGTCAAGGCTAGG - Intergenic
1121343386 14:93117898-93117920 CTGAAAGACCAGTTGAGGCTGGG + Intergenic
1121518667 14:94570687-94570709 CTGAAAGCACAGGGTGAGCTAGG - Intronic
1123904447 15:24907757-24907779 TTGAAAGCACAGAGTAGGCCAGG + Intronic
1124663223 15:31568174-31568196 CTGAAAGCAGAGAGCAGCCATGG + Intronic
1126125078 15:45288161-45288183 CTGAAAGCAGAGAAGAGTCTGGG - Intergenic
1126614019 15:50558246-50558268 TTCACAGCACAGATGAGGCTGGG + Exonic
1127115377 15:55721249-55721271 CTGTAGGCAGAGTGGAGGCTGGG - Intronic
1127328941 15:57920325-57920347 CTGAAAGCAAAGAGAAGACATGG + Intergenic
1127425828 15:58855414-58855436 AGGAAAGCACAGTGGATGCTAGG + Exonic
1128271195 15:66311471-66311493 TTGAAAGCACAAAGTAGCCTAGG + Intronic
1129349712 15:74948375-74948397 CTTAAAACCCAGAGGAGGCCGGG + Intergenic
1130915727 15:88303132-88303154 CTGAGAGAACAGAAGGGGCTTGG - Intergenic
1131746673 15:95456051-95456073 CTGAATTCACATAGGATGCTGGG + Intergenic
1132385720 15:101398577-101398599 CTGAAAGCACAGAGGAGGCTCGG + Intronic
1132942663 16:2515650-2515672 GGCAAAGAACAGAGGAGGCTGGG - Intronic
1133071634 16:3250313-3250335 ATGAAAGCAAAGAAGGGGCTGGG + Intronic
1134073791 16:11276556-11276578 CTGCCCTCACAGAGGAGGCTGGG - Intronic
1134125593 16:11613759-11613781 CCGAGGGCACAGAGGTGGCTGGG + Intronic
1136576084 16:31126239-31126261 CTGATAGCAATGAGGAGGCTGGG + Intronic
1138028597 16:53541605-53541627 CTGAGAGAACAGAGGTGACTGGG - Intergenic
1138502778 16:57458362-57458384 CTGCAGGCCCACAGGAGGCTGGG + Intronic
1139392293 16:66612581-66612603 AGGAAAGCAGAGAGGATGCTTGG - Intronic
1139609614 16:68046185-68046207 CAGGAAGCAGAGAGGAGGCAAGG - Intronic
1141221690 16:82075729-82075751 CTGCAAGCAAAGAAAAGGCTGGG + Intronic
1141641680 16:85345096-85345118 CTAGAAGCAGAGAGGAGGCCTGG - Intergenic
1142135496 16:88450146-88450168 CGGAAAGGGGAGAGGAGGCTGGG + Intergenic
1142743285 17:1942624-1942646 CAGCCAGCACAGAGGAGGCAAGG + Intronic
1143016763 17:3894924-3894946 CTTGACTCACAGAGGAGGCTTGG + Intergenic
1143253040 17:5536941-5536963 CTGAAAGCACAAAGGGAGCCGGG + Intronic
1143772368 17:9176878-9176900 GTGACAGCACAGAGGAGGCCAGG - Intronic
1144180998 17:12752665-12752687 CTGACAGGTCAGAGGAGGCTGGG - Exonic
1145012659 17:19378606-19378628 CTGAAAGCCTTGAGGAGGCGCGG + Intronic
1145982842 17:29024224-29024246 CTGGAAGCAAAGAGGAGACATGG - Intronic
1146041767 17:29461829-29461851 ATGAAAGCACAGAGGAGTCAAGG + Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1147978606 17:44261544-44261566 GGGAAAGAACGGAGGAGGCTGGG + Intronic
1148244278 17:46020396-46020418 CTGAAACCCCAGAGGGTGCTTGG - Intronic
1148461643 17:47842116-47842138 CTGAAACCACAAAGAAGTCTTGG + Intergenic
1148470255 17:47888851-47888873 CTGAAAGCACTGACCTGGCTGGG - Intergenic
1149268590 17:54953570-54953592 CTGGAAGCAGAAAGGATGCTAGG - Intronic
1149458908 17:56811443-56811465 CTGGAAGGAAAGGGGAGGCTGGG - Intronic
1150889929 17:69136022-69136044 CATAAAGAACAGAGGAGGTTGGG - Intronic
1151011349 17:70501044-70501066 TTGAAAGCAGAGAGGAGGGGAGG + Intergenic
1151192016 17:72405697-72405719 CGGAAGGCAAAGAGGAGGCAAGG + Intergenic
1151664629 17:75538497-75538519 ATGAATGAACAGAGGAGGCGAGG - Intronic
1152098391 17:78286461-78286483 CTGAAAGCCCAGGGGAGGCAGGG - Intergenic
1152299043 17:79484819-79484841 CAGCAGGCTCAGAGGAGGCTAGG - Intronic
1152425901 17:80218526-80218548 ATGGATGGACAGAGGAGGCTGGG + Intronic
1152664380 17:81558886-81558908 CTGAAAATAAAGAGAAGGCTGGG + Exonic
1152721201 17:81924593-81924615 CTGCAAGCACAGAGCAGGGAGGG + Intronic
1152761926 17:82113171-82113193 CTGAAAGGACAGGGCAGTCTTGG - Intronic
1152945710 17:83196384-83196406 TTGGAGACACAGAGGAGGCTGGG + Intergenic
1153248081 18:3093249-3093271 CTGAAAGGGCAGAGGAGGTGTGG - Intronic
1154155488 18:11941078-11941100 CTGAGAGAGGAGAGGAGGCTGGG - Intergenic
1156120870 18:33841396-33841418 CTGAAATCAGAGAGGGGGGTAGG - Intergenic
1156648533 18:39197154-39197176 CTATAAGCACAGATGAAGCTTGG + Intergenic
1157093072 18:44659466-44659488 CTGAAAGGAAAAAGGAGCCTTGG + Intergenic
1157332264 18:46712542-46712564 CTGCAGGCACAGAGGAGGGAGGG - Intronic
1158110838 18:53940035-53940057 CTCTAACCACAGGGGAGGCTCGG - Intergenic
1158277772 18:55787105-55787127 CTGAAAGGACCCAGGAGACTGGG - Intergenic
1158390003 18:57037224-57037246 CTGGAAACACAGAGGAAACTGGG - Intergenic
1158505634 18:58044276-58044298 CCGGGAGCGCAGAGGAGGCTCGG + Intergenic
1158547732 18:58410313-58410335 CTGTAAACTCAGAGGAGGGTTGG - Intergenic
1159118979 18:64147837-64147859 CTGAATTCACACAGGAGACTTGG - Intergenic
1160575319 18:79849683-79849705 CTGGAGGCAGAGCGGAGGCTGGG + Intergenic
1161280796 19:3444484-3444506 CTGAACAGACAGAGGATGCTTGG + Intronic
1162189400 19:8932885-8932907 GAGAAAGCACACAGGAGGGTTGG - Intronic
1163524147 19:17810193-17810215 CTGAAAACACAAAAGTGGCTAGG + Intronic
1163710846 19:18845868-18845890 CTCAAAGCAGAGATGAGGCCAGG + Intronic
1165827620 19:38714227-38714249 CTGGAGGCACCGAGGAGGGTTGG - Intronic
1165981240 19:39726226-39726248 CTCAAAGCACACAGCAGGTTGGG + Intergenic
1166285883 19:41828018-41828040 CAGAAAGCACAGAGAGTGCTTGG - Intergenic
1166738987 19:45102896-45102918 CTGGAGCCACACAGGAGGCTGGG + Intronic
1167181612 19:47908160-47908182 CTAAAAGAATAGAAGAGGCTGGG - Intergenic
1167182263 19:47913534-47913556 CTAAAAGAATAGAAGAGGCTGGG - Intergenic
1167182928 19:47918911-47918933 CTAAAAGAATAGAAGAGGCTGGG - Intergenic
1167183598 19:47924261-47924283 CTAAAAGAATAGAAGAGGCTGGG - Intergenic
1167184228 19:47929301-47929323 CTAAAAGAATAGAAGAGGCTGGG - Intergenic
1167184896 19:47934663-47934685 CTAAAAGAATAGAAGAGGCTGGG - Intergenic
1167185552 19:47940026-47940048 CTAAAAGAATAGAAGAGGCTGGG - Intergenic
1167186218 19:47945404-47945426 CTAAAAGAATAGAAGAGGCTGGG - Intergenic
1167186868 19:47950777-47950799 CTAAAAGAATAGAAGAGGCTGGG - Intergenic
1167187521 19:47956165-47956187 CTAAAAGAATAGAAGAGGCTGGG - Intergenic
1167251408 19:48400198-48400220 CTCAATCCACAGAGCAGGCTTGG - Intronic
1167460990 19:49624694-49624716 CTCAAAGGACAGAGGAGGCTGGG - Intronic
1167498741 19:49834038-49834060 ATGAAAGCACACAGGATGCGTGG - Intronic
1167541654 19:50092105-50092127 CTAAAAGAATAGAAGAGGCTGGG + Intergenic
1167542327 19:50097442-50097464 CTAAAAGAATAGAAGAGGCTGGG + Intergenic
1167542764 19:50100507-50100529 CTAAAAGAATAGAAGAGGCTGGG + Intergenic
1167543634 19:50106628-50106650 CTAAAAGAATAGAAGAGGCTGGG + Intergenic
1167544308 19:50111982-50112004 CTAAAAGAATAGAAGAGGCTGGG + Intergenic
1167544983 19:50117335-50117357 CTAAAAGAATAGAAGAGGCTGGG + Intergenic
1167545659 19:50122686-50122708 CTAAAAGAATAGAAGAGGCTGGG + Intergenic
1167546336 19:50128014-50128036 CTAAAAGAATAGAAGAGGCTGGG + Intergenic
1167547010 19:50133361-50133383 CTAAAAGAATAGAAGAGGCTGGG + Intergenic
1167547668 19:50138733-50138755 CTAAAAGAATAGAAGAGGCTGGG + Intergenic
1168242568 19:55094765-55094787 CTCCAAGCAAGGAGGAGGCTTGG + Exonic
1168656705 19:58134638-58134660 CTCAAAACACAGAGCAGGCCGGG + Intronic
925192581 2:1897367-1897389 CTTCCAGCACAGAGGATGCTTGG + Intronic
925437876 2:3856978-3857000 CTCAAAGCACACATGGGGCTTGG - Intergenic
926271799 2:11372238-11372260 CAGAGAGCACACAGGAGGTTGGG - Intergenic
926781610 2:16477837-16477859 CTTAAAGCACAGAAGTGGATGGG + Intergenic
926939901 2:18124541-18124563 GGGACAGCACAGATGAGGCTGGG - Intronic
927441016 2:23117942-23117964 CTCAAAGCACACAGCAGGCAGGG + Intergenic
927441232 2:23119498-23119520 CTGAAAGCAGAGGGGAGGGTTGG - Intergenic
928330102 2:30351213-30351235 CTGCAAACCGAGAGGAGGCTTGG - Intergenic
928587221 2:32772827-32772849 CTGAAAACCCAGAGGGGACTGGG - Intronic
930054843 2:47244052-47244074 CTGGAAACACTGAGCAGGCTTGG - Intergenic
930101370 2:47606022-47606044 CTGAGGGCACAGAGGAGTCATGG - Intergenic
930216044 2:48698633-48698655 CTAAAAGCACAGCAGTGGCTGGG + Exonic
933374383 2:81460834-81460856 CTGAAAGGAGAGAAGAGGGTTGG + Intergenic
934120061 2:88829615-88829637 CTGGATGCAGGGAGGAGGCTGGG + Intergenic
935518889 2:104078911-104078933 CTGAGAGCACAGAGATGCCTGGG + Intergenic
936076051 2:109402528-109402550 CTGTAGGCACCGAGGAGCCTGGG - Intronic
936479453 2:112871528-112871550 GTGGAAGCTCAGAGGAGCCTTGG + Intergenic
936780524 2:116027411-116027433 ATGAAAGAACACAGGACGCTAGG + Intergenic
936878288 2:117218862-117218884 CTGGAAGAGCAGAGGAGGGTGGG + Intergenic
939172832 2:138715629-138715651 CTAGAAGCAGACAGGAGGCTGGG + Intronic
939470677 2:142616050-142616072 CTGACAGCACTAAGGAGACTGGG + Intergenic
940440441 2:153709095-153709117 CTGAAAGCACAGAGAATGAAAGG + Intergenic
941624341 2:167814369-167814391 TTGGTAGAACAGAGGAGGCTTGG + Intergenic
942547043 2:177076007-177076029 CTCAGAGCACAGAGCAGGGTGGG + Intergenic
944285596 2:197946654-197946676 TTGAAAGTAGAGAGGAGGCCAGG - Intronic
944698716 2:202226856-202226878 TTAAAAGCACTCAGGAGGCTGGG + Intronic
945804524 2:214474264-214474286 CTGAAAGCAAAGAGGCAGCATGG + Intronic
946102188 2:217335104-217335126 CTGAAAGGAGAGAGGTGGCTGGG + Intronic
946366087 2:219249907-219249929 CATAATGCACAGAGGAGCCTGGG + Exonic
946415517 2:219538060-219538082 CTGAAAGGACCCAGGAGTCTGGG + Exonic
946782427 2:223205378-223205400 ATGCAAGCACACAGGAGGCAGGG - Intergenic
947167302 2:227275474-227275496 TAGAAATCACAGAAGAGGCTGGG - Intronic
947650883 2:231785467-231785489 TTGGAAGCACAGAAGAGGTTGGG - Intronic
947667413 2:231914993-231915015 CAGAAAGGACAGAGGAGGCCAGG + Intergenic
948560181 2:238847127-238847149 CTGCCAGCGCAGCGGAGGCTGGG + Intergenic
948982150 2:241499827-241499849 CTGAGAGCAGACGGGAGGCTGGG - Intronic
949065695 2:241989211-241989233 CTGAGAGCTCAGCGGAGGCTGGG + Intergenic
1168805744 20:671478-671500 GAGCAAGCACAGAGAAGGCTGGG - Intronic
1169068884 20:2709664-2709686 CTGGAAGCTCAGAGGAGAGTGGG + Intronic
1170035432 20:11984597-11984619 CAAAAAACACAGTGGAGGCTGGG - Intergenic
1170614560 20:17938310-17938332 CTGAAGGCAGGGAAGAGGCTGGG + Intergenic
1170743456 20:19077981-19078003 GTGAAAGCAGAGAGGAGGAGAGG + Intergenic
1170914820 20:20612671-20612693 CTGGAAGCACAGAAGAGGAAGGG + Intronic
1172050682 20:32115222-32115244 CAGGAAGTACAGAGGAGGTTGGG + Intronic
1172475467 20:35234200-35234222 GTGAATGAACAGAAGAGGCTAGG - Intronic
1172528515 20:35615816-35615838 CTGACGTCACAGAGGAGCCTCGG - Intergenic
1172926561 20:38542294-38542316 CTGAACTCACAGAAGATGCTGGG - Intronic
1172981214 20:38943317-38943339 TTAAAAGCACAGAGCAGGCTGGG - Intronic
1172991929 20:39042981-39043003 CTGAAGGCAATGAGCAGGCTAGG + Intergenic
1173080982 20:39867290-39867312 AAGAAATCACAGAAGAGGCTGGG + Intergenic
1174566723 20:51470008-51470030 CTGACAACACCGAGGAGGCTGGG + Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1174907203 20:54564044-54564066 CTGAAAGAAAATAGGAGTCTAGG - Intronic
1175954480 20:62602085-62602107 CAGAAAGCAAGGAGGAGGTTGGG - Intergenic
1176010007 20:62888156-62888178 CAGCAAGCACTGAGGGGGCTAGG + Intronic
1176044466 20:63085097-63085119 CAGAAAGTAGAGAGGAGGCTCGG + Intergenic
1176389023 21:6154239-6154261 AGGAAAGGACAGAGGAGGGTGGG + Intergenic
1178244428 21:30936930-30936952 CTGACAGCAGAGAGGAGGCCTGG - Intergenic
1178285424 21:31321644-31321666 TTTAAAACACAGAAGAGGCTGGG - Intronic
1178378376 21:32087611-32087633 ATGTAACCTCAGAGGAGGCTGGG - Intergenic
1178793783 21:35724245-35724267 ATTAAAACTCAGAGGAGGCTGGG - Intronic
1179734449 21:43384009-43384031 AGGAAAGGACAGAGGAGGGTGGG - Intergenic
1179988880 21:44935539-44935561 CAGAATGCAGAGAGGGGGCTAGG - Intronic
1181027561 22:20134625-20134647 CTGAGTGCAGAGAGGGGGCTGGG - Intronic
1181495251 22:23283954-23283976 CTGCAGGCACAGGGAAGGCTGGG - Intronic
1182275247 22:29184233-29184255 CTGAAAGGACATAACAGGCTGGG - Intergenic
1182577451 22:31282731-31282753 AGTAAAGCACAGAGGAGCCTGGG + Exonic
1182725106 22:32439028-32439050 CAGAAAGCACAGATTGGGCTGGG + Intronic
1183311592 22:37112673-37112695 TTGAAAGCACAGACGTGGCTGGG + Intergenic
1184664023 22:45978140-45978162 GAGAAAGCACAGAGCAGGCAGGG - Intergenic
1184715957 22:46281948-46281970 CTGTAAGGACAGAGAAGTCTGGG - Intronic
1185111290 22:48901547-48901569 CTGGAAGCAGGGAGGAGGCTTGG + Intergenic
1185111618 22:48903221-48903243 CCGGAAGCAGGGAGGAGGCTTGG - Intergenic
1185221915 22:49633283-49633305 CAGAAAGAGCAGAGGAGGCAGGG - Intronic
949967764 3:9373195-9373217 TTTAAATCCCAGAGGAGGCTGGG + Intronic
950102524 3:10366739-10366761 CTGAAAGCTCAGCTGTGGCTCGG + Intronic
950884622 3:16352596-16352618 CTAAAAGCACAGAGGAGGTTGGG - Intronic
950941373 3:16896369-16896391 CTGAAAGCACAAAAGGAGCTGGG + Intronic
952613959 3:35246727-35246749 GTGGAAGCACAGAGTAGACTGGG + Intergenic
952941627 3:38449551-38449573 ATGAAAACACAGAGTAAGCTGGG - Intergenic
953771386 3:45780677-45780699 CTGAGAGCACAGAGAGGGGTGGG + Intronic
954107363 3:48416452-48416474 CTGTAGGCACAGGGCAGGCTAGG + Intronic
955032176 3:55232210-55232232 CTCAAAGCAGGGAGGAGGCCTGG + Intergenic
955101368 3:55853229-55853251 TAGAAAGCACTCAGGAGGCTGGG + Intronic
955217304 3:56994994-56995016 CAGAAGGCAAAGAGGAGGCATGG - Intronic
955391289 3:58524287-58524309 CTGAGAGGACCGGGGAGGCTAGG + Intronic
956564013 3:70615238-70615260 ATGAAAGCATGAAGGAGGCTTGG - Intergenic
956751970 3:72350786-72350808 CTGAGTCCTCAGAGGAGGCTGGG + Intergenic
957743823 3:84311623-84311645 CTGAAATCACACATCAGGCTAGG + Intergenic
960804009 3:121565335-121565357 CTGAAAGTTCAGGAGAGGCTGGG + Intergenic
960971709 3:123144587-123144609 AGAAAAGCACAGAGCAGGCTGGG + Intronic
960996025 3:123340832-123340854 CTGAAAGCACAGGCCAGGCATGG + Intronic
961853906 3:129850171-129850193 TTGAAAGGACAGAGGAGAATAGG - Intronic
962298595 3:134216410-134216432 CTGAAAGCACAGAACAGCCATGG + Intronic
962328466 3:134456033-134456055 CTGAATGCACAGGGGAGTCGGGG + Intergenic
962809308 3:138947442-138947464 CTGAAAGCCGCGAGGAGGCTTGG - Exonic
962891944 3:139679551-139679573 CAGAGAGCAGAGAAGAGGCTGGG + Intergenic
963125890 3:141815848-141815870 CTGAAGGCTCAGCTGAGGCTGGG - Intronic
963318525 3:143786792-143786814 ATGAATGCACAGAGGAAGCATGG + Intronic
963623961 3:147647585-147647607 CTGTAAGCCCAGCTGAGGCTGGG - Intergenic
963823563 3:149926503-149926525 CTAAAAACACAGAAGAGGCTGGG - Intronic
964381787 3:156104943-156104965 ATGAAAGCACAGTGGAGGTGAGG - Intronic
966421226 3:179736401-179736423 CTGAAAGCAGAGAGTAGGCATGG + Intronic
967088460 3:186115032-186115054 ATGAAAGGACTCAGGAGGCTTGG - Intronic
967989681 3:195121609-195121631 TAGAAAGCACAGAGGAGGTTTGG - Intronic
968741096 4:2332185-2332207 CTGAGAGCAGAGGGGAGGCAGGG - Intronic
968750729 4:2387553-2387575 GGGAGAGCACAGAGGAGGCCTGG + Intronic
969229444 4:5819642-5819664 CTGACAGGACTGAGGAGGCCAGG + Intronic
969253579 4:5987884-5987906 CTGAAAGCACAGAGCCGGGTTGG + Intronic
969893716 4:10283070-10283092 CACACAGCACAGAGGATGCTGGG - Intergenic
970527789 4:16949863-16949885 TTAAAAGAACAGAGTAGGCTGGG + Intergenic
970679390 4:18489528-18489550 CTGATAGCGCTAAGGAGGCTGGG + Intergenic
971340918 4:25768021-25768043 CTGAACTCACAGACAAGGCTGGG + Intronic
972793755 4:42397342-42397364 CAGAAAGCGCAGAGGACCCTCGG + Intergenic
974124501 4:57679207-57679229 CTGACAGCACAAACGAGGGTAGG - Intergenic
975268780 4:72404182-72404204 GTGAAACCACAGAGGACCCTTGG + Intronic
975845766 4:78523855-78523877 GTGAAACCAGAGGGGAGGCTGGG - Intronic
979478514 4:121186322-121186344 CTGAAAGCACACAGGAGGGGTGG + Intronic
981013943 4:139953889-139953911 CTGATAGCAGAGAGGAGTCAGGG + Intronic
981019672 4:140012400-140012422 CTGATTGCATACAGGAGGCTGGG - Intronic
983249725 4:165329927-165329949 CTAAAATCACTAAGGAGGCTGGG - Intronic
985075365 4:186208815-186208837 CTGAAAGAGCAGTGGGGGCTGGG - Intronic
985723629 5:1503888-1503910 ATGAAACCAGAGAGCAGGCTTGG - Intronic
985754079 5:1702734-1702756 TTGAGATCCCAGAGGAGGCTTGG - Intergenic
985864455 5:2503310-2503332 CGGAAACCACAGAGGAGTCCGGG - Intergenic
986029190 5:3879918-3879940 CTGAAAGCACAGGAGAAGATGGG - Intergenic
986818403 5:11437896-11437918 CTGCAAGCTCAGGGGTGGCTAGG + Intronic
987834888 5:23147346-23147368 TTGAAAGGAGAGAGAAGGCTGGG - Intergenic
990296396 5:54405862-54405884 CTGAAAGGAAAGTGGAGCCTTGG - Intergenic
990875405 5:60478776-60478798 CTGCAAGCATGAAGGAGGCTGGG - Intronic
993363620 5:87007677-87007699 CTTAAAACACAGTTGAGGCTGGG - Intergenic
993524965 5:88954073-88954095 CAGACAGCACAGAGGAGGGAGGG - Intergenic
994658110 5:102619568-102619590 TTAAAATCACAGAAGAGGCTGGG + Intergenic
994682816 5:102910380-102910402 CTGAAAGCACAGAGGTTGGAGGG - Intronic
994753297 5:103764660-103764682 CTGAAATCAAAGCGGACGCTAGG + Intergenic
994804510 5:104427483-104427505 CTCAAAGCAAAGAGAAGACTAGG + Intergenic
995009182 5:107238967-107238989 CTGATAGCCTAGAGGAGGATGGG - Intergenic
995424672 5:112007106-112007128 CATCAAGCACAGAGGAGGCTGGG + Intergenic
995709923 5:115025021-115025043 CTGAAAGCACAGAGAGCACTTGG + Intergenic
996756921 5:126945351-126945373 ATGATAGCACAGAGGAACCTGGG + Intronic
997527142 5:134560686-134560708 TTCAAAGCTCAAAGGAGGCTGGG + Intronic
997777229 5:136621434-136621456 CTAAAAGCAGACAGGAGGCATGG - Intergenic
998016265 5:138734661-138734683 CTGGCCGCAGAGAGGAGGCTGGG - Intronic
999044187 5:148449710-148449732 CAGACACCACAGAGGAGACTAGG - Intergenic
999624179 5:153502653-153502675 CAGAAAGCACAGGGGAGCCCAGG + Intronic
1000850569 5:166335151-166335173 CTGAAAACACTGAGGTAGCTGGG - Intergenic
1001058889 5:168471497-168471519 CTCAAAGCTCAGAGGAGTGTAGG - Intronic
1001101657 5:168819294-168819316 CCAAAAACAGAGAGGAGGCTTGG + Intronic
1001433591 5:171682522-171682544 CTGAAAGCACAGCTGAAGCAGGG - Intergenic
1001724402 5:173884948-173884970 CTCAAACCCCAGAGGGGGCTGGG + Intergenic
1002693799 5:181070634-181070656 CCAAGAGCACAGAGGGGGCTCGG + Intergenic
1003280930 6:4690693-4690715 CTGAAAGGTCACAGAAGGCTAGG - Intergenic
1003760835 6:9177067-9177089 CTGAAAGCACACTGGGAGCTGGG - Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1006393390 6:33771957-33771979 CTGAGAGCAGAGAGGAGGGTCGG - Exonic
1007799033 6:44376119-44376141 GTGGAAGCACAGAGGAGCCCAGG + Intronic
1008052046 6:46910136-46910158 CTCAGAGCTCAGAGGTGGCTAGG + Intronic
1008819157 6:55609596-55609618 CTGCAAGCTCTGAGGAAGCTGGG + Intergenic
1009236638 6:61132331-61132353 CTGACAGGACAGAAGAGACTGGG - Intergenic
1012059875 6:94464946-94464968 CTGAAAGCAAAGGGTAGTCTTGG - Intergenic
1013287438 6:108693424-108693446 TTGAAAGGACAGAGTAGGCCGGG - Intergenic
1015348874 6:132193589-132193611 TAGAAAGCACAGATAAGGCTGGG + Intergenic
1017908348 6:158772048-158772070 CCGAGTGCACAGCGGAGGCTGGG - Intronic
1018866310 6:167749055-167749077 TTGAAAACACAGGCGAGGCTTGG + Intergenic
1019575836 7:1737236-1737258 CTGCAGGGAAAGAGGAGGCTTGG - Intronic
1019803025 7:3102567-3102589 TTAAAAGCACAGAGGGGGCCGGG + Intergenic
1022245770 7:28557759-28557781 CTGTGAGCACACAGGAGCCTTGG - Intronic
1022253785 7:28635168-28635190 ATGAAGGCAAGGAGGAGGCTTGG + Intronic
1023881560 7:44324289-44324311 CTGAAGGGACGGAGGAGGATGGG + Intronic
1024185815 7:46946759-46946781 CTGAAAGAGCAAAGGAGGCCAGG - Intergenic
1025189026 7:56882655-56882677 CCAAAAGCACAGAGGAAGATGGG - Intergenic
1025682913 7:63694264-63694286 CCAAAAGCACAGAGGAAGATGGG + Intergenic
1026795767 7:73365091-73365113 CTGAAAGTGCAGCTGAGGCTGGG + Intergenic
1028484524 7:91343436-91343458 CTGAAGTCATAGGGGAGGCTGGG - Intergenic
1029111414 7:98214683-98214705 CTGAAAGCCCAGAAGAGCCTCGG + Exonic
1029483120 7:100824720-100824742 CTGAAAGCAGAGAGGGGTCTTGG - Intronic
1030111034 7:106027099-106027121 TTGAAAGAACAGATAAGGCTGGG + Intronic
1030226682 7:107159663-107159685 CTGAAATCACAGAAAATGCTTGG - Exonic
1030605071 7:111632136-111632158 ATGAAAGGAAATAGGAGGCTGGG - Intergenic
1031928724 7:127663180-127663202 TTTAAAGCATACAGGAGGCTGGG - Intronic
1032278825 7:130485037-130485059 GAGAAAGCACAGAGGAGGGAGGG + Intergenic
1033319874 7:140329864-140329886 CTAAAGGCACAGAAGAGGCAAGG + Intronic
1033619390 7:143048822-143048844 TTGAAAGCAAAGAAGAGGCTGGG - Intergenic
1034032832 7:147786670-147786692 CAGAAAGCACTGTGGAGGCCTGG + Intronic
1036973509 8:13382210-13382232 CTGAAATGAAAGAGGAGGCCGGG + Intronic
1037096169 8:14990397-14990419 CTGAAAGTACAGATGCAGCTTGG - Intronic
1037269854 8:17114822-17114844 CTTAAACCCCAGAGGAGGCCGGG + Intronic
1037644041 8:20774008-20774030 CTGCAAGCCCAGAGGAGGGCAGG - Intergenic
1038312340 8:26454118-26454140 CTGATGCCCCAGAGGAGGCTGGG + Intronic
1038806979 8:30803245-30803267 CTGAAAGCACAAAGGAGGCCGGG + Intronic
1040110516 8:43565103-43565125 GTGAGAACAAAGAGGAGGCTGGG - Intergenic
1040456677 8:47605167-47605189 CTGAGGAGACAGAGGAGGCTGGG + Intronic
1041398770 8:57419325-57419347 CTGATAGCATAGGGGATGCTGGG + Intergenic
1042667757 8:71225196-71225218 TTGAAAGCACAGTGAGGGCTTGG - Intronic
1044755031 8:95452651-95452673 CTGGATGCACAGAGGATGATGGG - Intergenic
1044844241 8:96364643-96364665 CTGACAGCTCAGTGGAGTCTGGG + Intergenic
1046607231 8:116384851-116384873 ACAAAAGAACAGAGGAGGCTGGG + Intergenic
1047284715 8:123477807-123477829 ATGAAAGCACAGAGAAGGTAAGG + Intergenic
1047615946 8:126562594-126562616 AGGAAAGCAAAGAGCAGGCTGGG + Intergenic
1047727746 8:127698722-127698744 CAGAAGGCACAGAGGAGGTGGGG + Intergenic
1047752202 8:127890318-127890340 CTGAGAGGGGAGAGGAGGCTGGG - Intergenic
1048332265 8:133478881-133478903 CTCAATGCTCAGTGGAGGCTTGG + Intronic
1048575373 8:135685938-135685960 CTGGGAGTCCAGAGGAGGCTAGG - Intergenic
1049070445 8:140351471-140351493 CTTAAACCATATAGGAGGCTGGG + Intronic
1049244277 8:141553380-141553402 CTCAATGCACAGAGAAGCCTTGG - Intergenic
1049540154 8:143205020-143205042 GTGAAATCACAGAGAAGGATGGG - Intergenic
1049763565 8:144342405-144342427 CTGAAAGCAAGAAGGAGGCGGGG - Intergenic
1050007858 9:1152748-1152770 ATGAAAGAATAAAGGAGGCTGGG + Intergenic
1050597214 9:7216031-7216053 ATAAAAGCAAAGAGGAGGCTGGG - Intergenic
1051158139 9:14173887-14173909 CTAGAAGCACTGTGGAGGCTGGG + Intronic
1053128052 9:35598937-35598959 CTGAAAGCACAGGGATGCCTGGG - Intergenic
1053311666 9:37024638-37024660 CTGGCAGCACAGTGGGGGCTGGG - Intronic
1053596868 9:39571789-39571811 TTGAGGGCACAGAGGAGGATGGG + Intergenic
1054569386 9:66793210-66793232 TTGAGGGCACAGAGGAGGATGGG - Intergenic
1055093805 9:72389747-72389769 AAGAAAGCAGAGAGGAGGCTGGG + Intergenic
1055120365 9:72653333-72653355 CTGAAAGCACAAACCAGGTTAGG - Intronic
1055480525 9:76705029-76705051 CTGAAACAATAGAGGAAGCTGGG - Exonic
1055990431 9:82100252-82100274 TTAAAAGCACAGAGTGGGCTGGG - Intergenic
1056660406 9:88539039-88539061 CAGCAAGCGGAGAGGAGGCTGGG - Intronic
1057013556 9:91630475-91630497 CTGAATGCCCAGTGGAGGCAGGG + Intronic
1057511531 9:95683687-95683709 CTAAAAATACAAAGGAGGCTGGG + Intergenic
1057946131 9:99330528-99330550 TAGAAAGCACAGAGGTGGCTAGG - Intergenic
1058703758 9:107622115-107622137 CTGGAAGGACAGAGAAGGCCCGG - Intergenic
1058850818 9:109010872-109010894 CTAAAAGCTCAGAGAAGGCATGG - Intronic
1059246497 9:112854203-112854225 CTGGAAGCACACACCAGGCTTGG + Intronic
1059422961 9:114204403-114204425 CTGAAAGCACACAGTCAGCTTGG + Intronic
1059449820 9:114363647-114363669 CTCAAAGCACAGAGCAGGGTGGG - Intronic
1059481366 9:114593158-114593180 CAGAAAGCATAGAGGAGGCAGGG + Intronic
1059492359 9:114679331-114679353 CTTAAAGAACAGAGGAGATTTGG - Intergenic
1059531440 9:115039130-115039152 CTCAAAGCTCAGAAAAGGCTCGG - Intronic
1060359369 9:122940847-122940869 CTGAAAGCCCAGGTGGGGCTCGG + Intronic
1060399586 9:123340502-123340524 CAGAGAGCAGAGAGGAGCCTGGG - Intergenic
1060491465 9:124088293-124088315 CAGAAGGCACAGATGAGGCCAGG - Intergenic
1061091945 9:128431531-128431553 CTGAGAACACAGAGGAGGACAGG + Intronic
1061806947 9:133142017-133142039 CAGAAAGCACAGCGATGGCTCGG - Intronic
1061825978 9:133258445-133258467 CTGTGGGCAGAGAGGAGGCTGGG + Intronic
1185824345 X:3235524-3235546 CTGAAAGAACAAAGTAGTCTTGG + Intergenic
1186468374 X:9802427-9802449 CTCAAATAACAGAGGATGCTGGG - Intronic
1186948825 X:14599193-14599215 CTGAATGCACAGTGGAGGAACGG + Intronic
1187629241 X:21149964-21149986 TTGAAAGTACAGTGTAGGCTTGG + Intergenic
1188002571 X:24995992-24996014 GTGGAGGCACAGAGGAAGCTGGG - Exonic
1189380901 X:40501405-40501427 ATGACAGCACAGAGGCTGCTGGG - Intergenic
1190777296 X:53563172-53563194 GTGAAACCACAGAGGATACTGGG + Intronic
1191174148 X:57482018-57482040 CTGAAAGCACTGAGGAGGCTGGG - Intronic
1192206230 X:69098233-69098255 GTAAAAGCACAGAGGAGGGAAGG - Intergenic
1192707426 X:73541248-73541270 CTGACAGTACTAAGGAGGCTGGG + Intergenic
1193071904 X:77315029-77315051 CTGAAAGCATGAAGGAGGCCTGG + Intergenic
1193113751 X:77756127-77756149 CTGACAGCACTAAGGAGGCTGGG - Intronic
1193571682 X:83152031-83152053 CTGACAGTACTAAGGAGGCTGGG + Intergenic
1193825204 X:86216797-86216819 TTGAAAACAAACAGGAGGCTGGG + Intronic
1195612270 X:106881408-106881430 CTGAAAGCAATGAGGAGGGTAGG + Intronic
1196222072 X:113123010-113123032 CAGAAATGACAGAGAAGGCTTGG + Intergenic
1196476432 X:116091975-116091997 CTGACAGTGCAAAGGAGGCTGGG - Intergenic
1197942113 X:131801428-131801450 CTGAAGGCACTGTGGAGGCTGGG + Intergenic
1198891733 X:141403863-141403885 CTGAAAAGAGAGAGGAAGCTGGG - Intergenic
1199934530 X:152559387-152559409 TTGAAATCACAATGGAGGCTAGG - Intergenic
1200161520 X:154012281-154012303 CTGAAAGCACAGAGTGGGGCAGG + Intronic