ID: 1132387741

View in Genome Browser
Species Human (GRCh38)
Location 15:101412161-101412183
Sequence CTGTTGCTGCAGAGGACAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 250}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132387741_1132387748 5 Left 1132387741 15:101412161-101412183 CCCCTTGTCCTCTGCAGCAACAG 0: 1
1: 0
2: 0
3: 22
4: 250
Right 1132387748 15:101412189-101412211 GAGAAGCCAGCTGAAACAGAAGG 0: 1
1: 0
2: 3
3: 37
4: 401
1132387741_1132387750 16 Left 1132387741 15:101412161-101412183 CCCCTTGTCCTCTGCAGCAACAG 0: 1
1: 0
2: 0
3: 22
4: 250
Right 1132387750 15:101412200-101412222 TGAAACAGAAGGCTGAAGTCAGG 0: 1
1: 0
2: 1
3: 23
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132387741 Original CRISPR CTGTTGCTGCAGAGGACAAG GGG (reversed) Intronic
901196997 1:7445794-7445816 CTGCTGCTACAGAGGGCCAGGGG + Intronic
903501819 1:23804551-23804573 CAGTTGTTGCTGGGGACAAGAGG + Intronic
904268741 1:29334371-29334393 CTGGAGCTGCAGAGGCTAAGTGG + Intergenic
904283949 1:29442196-29442218 CTATTGCTGCAGATGGCAACTGG + Intergenic
904413573 1:30341024-30341046 CTGTTGGAGCAGAGGACAGTGGG - Intergenic
906007743 1:42492182-42492204 CTGTTGGTGCTGAGCATAAGAGG - Intronic
906382751 1:45343155-45343177 AGGCTGCGGCAGAGGACAAGCGG + Exonic
907268153 1:53275234-53275256 CTGCTCCTGCAGAGGGCAGGTGG + Intronic
911502121 1:98700294-98700316 AGGTTGCTTCAGAGGACAACTGG - Intronic
912716254 1:111985817-111985839 CAGATGCTGCAGAAGACAATAGG + Intronic
913464578 1:119126854-119126876 CTGTTGGTGCTGAGCATAAGAGG + Intronic
915758046 1:158282230-158282252 GTGTTCCTTCAGAGGAGAAGAGG + Intergenic
916425219 1:164673873-164673895 CTTTTGTAGCAGAGGACAAGGGG - Intronic
919499409 1:198316981-198317003 ATGTTGCTGGAGTGGATAAGTGG + Intronic
920211539 1:204332154-204332176 ATGTTGCTGCAGGGGACAGAGGG + Intronic
920538781 1:206761429-206761451 CCCTGGCTGGAGAGGACAAGGGG - Intergenic
920575911 1:207060109-207060131 ATCTTGCTGCAGAGGAGAGGTGG - Intronic
921240435 1:213175477-213175499 GTGATGCTGCAAAGGACAACAGG - Intronic
921998982 1:221454707-221454729 CTGTTGCTCCAGATGACACAGGG - Intergenic
922548552 1:226476634-226476656 CTGATGGTGGTGAGGACAAGCGG + Intergenic
923129258 1:231060941-231060963 TGGTTTCTGCTGAGGACAAGAGG + Intergenic
923538200 1:234869282-234869304 TAGATGCTGCAGAGGCCAAGAGG - Intergenic
924031999 1:239895132-239895154 CTACTGCTGCAGAGAAAAAGAGG - Intronic
1063280901 10:4628400-4628422 ACCTTGCTGAAGAGGACAAGTGG - Intergenic
1063356322 10:5402427-5402449 CTGATGATGCAGAAGACATGGGG - Intronic
1064687908 10:17883530-17883552 CTCTTTCTGCAGAGTAGAAGAGG - Intronic
1065197767 10:23283628-23283650 CTGTAGCTGAAGAGAACATGAGG - Intronic
1065880497 10:30033735-30033757 CTGTTGCTGCATAGAACTGGTGG - Intronic
1066465997 10:35650761-35650783 CTGTTGCACCACATGACAAGAGG + Intergenic
1067160784 10:43823192-43823214 CTATTGCTGCAGAATTCAAGTGG + Intergenic
1067346608 10:45442787-45442809 GTGGGGCTGCAGAGTACAAGAGG - Intronic
1070291257 10:75116428-75116450 GAGTTGTGGCAGAGGACAAGAGG + Intronic
1071312944 10:84361030-84361052 CTTTTGCTTCAGAGGACAGAAGG + Intronic
1072458181 10:95595045-95595067 CTGTTGGTGCTGAGCATAAGAGG - Intergenic
1074054590 10:109911106-109911128 CCCTTGCTGCAGATGATAAGTGG - Intronic
1075153519 10:119955825-119955847 CAGTTGCAGCAGAGGCCCAGTGG + Intergenic
1075454049 10:122573475-122573497 CTGTGGCAGCAGAGGACATGGGG + Intronic
1076426446 10:130370654-130370676 CTCTTGCTGAAGAGGCCAACAGG - Intergenic
1076688237 10:132207836-132207858 GTGGTGGTGCAGGGGACAAGAGG - Exonic
1076916241 10:133424213-133424235 CGGATGCTGCGGAGGACAAGCGG + Intronic
1076936349 10:133569008-133569030 CGGATGCTGCGGAGGACAAGCGG + Intronic
1077228182 11:1447372-1447394 GAGTTGCAGCAGAGGCCAAGAGG - Intronic
1077498435 11:2897873-2897895 ATGATGCTGCAGAGGACAGAAGG - Intronic
1077597896 11:3550041-3550063 CTGTTGGTGCTGAGCATAAGAGG + Intergenic
1083636292 11:64122708-64122730 CTGGTGCTCCAGAGGCCAAGTGG + Intronic
1083729135 11:64643515-64643537 GTGTTGCTGCAGAGGCTGAGAGG + Intronic
1084151622 11:67290211-67290233 CAGGTACTGCAGAGGACAAGGGG + Exonic
1085296776 11:75435857-75435879 CTGTGGCTGCAGAGTCCCAGGGG - Intronic
1088710049 11:112499731-112499753 CTGCTGTTCCAGAGGACAAAAGG + Intergenic
1089047284 11:115513267-115513289 ATGTTTTTGCAGAGGGCAAGAGG + Intergenic
1090226798 11:125076612-125076634 TTCTTGGTGCAGAGGCCAAGGGG - Intronic
1090876882 11:130798162-130798184 TTCTGGCTGCAGGGGACAAGTGG + Intergenic
1091602689 12:1927684-1927706 CTGAGGCTGAGGAGGACAAGGGG + Intergenic
1091778006 12:3197313-3197335 GTGAGGCTGCAGAGGACAAAAGG + Intronic
1092283105 12:7112247-7112269 CTGCTGGTATAGAGGACAAGGGG + Intergenic
1093498086 12:19780058-19780080 CTGTAGCTGCAGAGGCAGAGGGG + Intergenic
1093541232 12:20287814-20287836 CTGTTACTTCACAGGACAACAGG - Intergenic
1093782645 12:23154872-23154894 CTGTGGCTGCTGAGGCCAGGTGG + Intergenic
1093889344 12:24500955-24500977 CTGTTGCTGCTGAGGAGGGGAGG - Intergenic
1095960705 12:47832800-47832822 CTGTTCCTCAAGAGGCCAAGTGG - Intronic
1096332658 12:50727877-50727899 CTATAGATGCAGAGGCCAAGTGG + Intronic
1099328170 12:81246097-81246119 CTGCTGCTGCAGAGAGCAAGTGG + Intronic
1099813908 12:87620968-87620990 ATGTTGTGGCAGAGGCCAAGTGG - Intergenic
1100665708 12:96750273-96750295 CTGCTGCTGCAGGAGACAGGTGG - Intronic
1101321047 12:103673460-103673482 CAGTTACTGCAGAGGCCGAGAGG - Intronic
1104717544 12:131026075-131026097 CTCAGGCTGCAGAGGGCAAGTGG + Intronic
1108436696 13:50407636-50407658 CTGTGGCTGCAAAGGTCTAGGGG + Intronic
1108773106 13:53729843-53729865 ATGTTTCTCAAGAGGACAAGGGG + Intergenic
1110734520 13:78920288-78920310 ATGTTGCTGCAAAGGACATAAGG + Intergenic
1111410725 13:87873324-87873346 CTGGTAAAGCAGAGGACAAGTGG + Intergenic
1112063795 13:95769363-95769385 CTGTTTATGTGGAGGACAAGGGG + Intronic
1113076803 13:106475049-106475071 ATTGTGCTGCAGAGGCCAAGTGG - Intergenic
1113668594 13:112159478-112159500 CTGTTTCCCGAGAGGACAAGTGG + Intergenic
1118036650 14:61875686-61875708 CTGTTACTGCAGAGCACTAAAGG + Intergenic
1119709238 14:76809381-76809403 ATGCTGCTTCAGAGGACAGGTGG - Exonic
1122731639 14:103803933-103803955 CTGTTACAGCAGGGGAGAAGAGG - Intronic
1124653390 15:31488769-31488791 GTGTTGCTTAAGAGGAAAAGTGG + Intronic
1125087378 15:35746315-35746337 CTGTTGCTGAGGAGGACCTGAGG - Intergenic
1125872636 15:43116014-43116036 CTGTTGGTGCTGAGCATAAGAGG + Intronic
1126862846 15:52903476-52903498 GTGATCCTTCAGAGGACAAGAGG - Intergenic
1127523497 15:59768809-59768831 CTGTTGGTGCTGAGCATAAGAGG - Intergenic
1129323878 15:74789454-74789476 CTGGTTCTGCAGAGGACACCAGG - Intronic
1131216691 15:90542669-90542691 CTTTTGCTACAGAGGACAGCAGG - Intronic
1132387741 15:101412161-101412183 CTGTTGCTGCAGAGGACAAGGGG - Intronic
1133374216 16:5270630-5270652 CTGTTGGTGCTGAGCATAAGAGG - Intergenic
1135392512 16:22105472-22105494 CTGTGTCTGCAGAGGATAAAAGG + Intronic
1136550511 16:30980131-30980153 CGGCTGCTGCAGCAGACAAGCGG + Exonic
1138146124 16:54613161-54613183 CTGTTGATGCAGGAGACAAAGGG + Intergenic
1138350695 16:56344868-56344890 CTGTGGTTGCAGAGGTCTAGAGG + Exonic
1140508771 16:75492338-75492360 GTGTTGCTGCACAGAAGAAGTGG - Intronic
1141172956 16:81702613-81702635 CTGTTGCAGCAAAGGAAAGGCGG + Exonic
1141599228 16:85115132-85115154 GCTTTGCTGCAGAGGTCAAGTGG + Intergenic
1143184583 17:5002653-5002675 CTGATGGAGCAGAGGGCAAGGGG + Intronic
1144724586 17:17495534-17495556 TTGTTGCCGCAGATGACCAGGGG + Exonic
1144912480 17:18694911-18694933 CTGATGCTGCAGAGGTGCAGTGG - Intergenic
1146195931 17:30812825-30812847 ATCTTTCTGGAGAGGACAAGGGG + Intronic
1147218477 17:38914489-38914511 CTGTTGGTGCAGATGACCTGAGG + Intronic
1148238524 17:45984667-45984689 CTCCCTCTGCAGAGGACAAGGGG + Intronic
1150150707 17:62807280-62807302 CTGTGACTGCAGAGAAAAAGGGG + Intronic
1150540666 17:66095196-66095218 CTATTGCTGCAGTGAACATGGGG - Intronic
1151239553 17:72747089-72747111 CTATTGCTGGAGTGGACAATGGG + Intronic
1152727210 17:81953262-81953284 CAGTGGCTGCAGAGGAAAACCGG + Exonic
1153060559 18:990683-990705 CTTTTGCTGCAGATGATTAGAGG + Intergenic
1155551068 18:26965711-26965733 CTGTTGCTGCAGGAGTGAAGAGG - Intronic
1157689463 18:49669072-49669094 CTTTGGCTGCAGAGCACAATAGG - Intergenic
1158741707 18:60150028-60150050 CTGTTGTTGCTGAGCATAAGAGG - Intergenic
1158789300 18:60757216-60757238 TAGTGGCTGCAGTGGACAAGAGG - Intergenic
1159844026 18:73437218-73437240 GGATTGCTGCAGAAGACAAGAGG + Intergenic
1160504650 18:79420156-79420178 AGGTTGCTGCAGAGGGGAAGAGG + Intronic
1160504757 18:79420770-79420792 ATGTCGTTGCAGAGGGCAAGAGG + Intronic
1160582895 18:79897783-79897805 CTGTTGCTGGGGAGGAAGAGGGG - Intronic
1160599644 18:80002917-80002939 CTGTTGCTGGAGGGTTCAAGAGG - Intronic
1165454912 19:35904778-35904800 CTGATGAGGCAGAGGAGAAGGGG - Intronic
1166160827 19:40951567-40951589 CAGGTGCTGCAGAGGCCAAAAGG - Intergenic
1166264787 19:41672825-41672847 CTTGTGCTGCAGATGAGAAGAGG + Intronic
1168686795 19:58353768-58353790 CTGGAGCTGCTGAGGTCAAGTGG + Intergenic
925857722 2:8146383-8146405 GTGTTGCTGAAAAGGACGAGAGG - Intergenic
926289664 2:11518504-11518526 CTGCTGCTGCAGTGGGCAGGGGG + Intergenic
927193576 2:20533133-20533155 CTGGTGCTGCAGAGAGCCAGTGG - Intergenic
929920378 2:46167395-46167417 CTGTTGGTGAGGAGGACAACAGG + Intronic
929997308 2:46836696-46836718 CTGTAGCAGCGGAGGCCAAGTGG - Intronic
930241233 2:48937640-48937662 CTTTTGCTGCAGAAAACAGGTGG + Intergenic
936721910 2:115261577-115261599 CATGTGCTGGAGAGGACAAGGGG + Intronic
937884197 2:126889111-126889133 CAGCTGCTGCAGAGGAGGAGAGG - Intergenic
937985715 2:127637266-127637288 CTGTGGGTGCAGAGGGCAGGTGG - Intronic
940433723 2:153625671-153625693 CTGTTGCTGAAGAGAAAAAATGG + Intergenic
940617534 2:156068512-156068534 CTTTTGCTTCAGGGGACAATAGG + Intergenic
941811074 2:169756632-169756654 CTGCTGCTCCAGAGGGCACGAGG + Intronic
942135169 2:172918273-172918295 CTATTGATGAAGAGGAGAAGTGG + Intronic
942372096 2:175296038-175296060 CTGAGGCTGCAGAGGGAAAGGGG - Intergenic
945367753 2:208977601-208977623 CTATGTCTGCAGAAGACAAGAGG - Intergenic
946371068 2:219281706-219281728 CTCTTTTTGCAGAGCACAAGCGG + Exonic
946409826 2:219510424-219510446 CTGAGGCTGCAGAGGGCAAAGGG - Intergenic
946596177 2:221308165-221308187 TTGCTGCTGGAGAGGGCAAGTGG - Intergenic
947047089 2:225999930-225999952 GTGTTGATGCAAAGGACAATAGG - Intergenic
947295879 2:228629490-228629512 CTGTTGCTTCAAAGGGCAAAAGG + Intergenic
1169519382 20:6354757-6354779 CTGTTTCTGAAGAGGAAAAGGGG + Intergenic
1169926024 20:10784837-10784859 CTGTTGCTGCTCATAACAAGTGG + Intergenic
1171342831 20:24444123-24444145 GTTTTGCTGCACAGGGCAAGAGG - Intergenic
1171486758 20:25491165-25491187 CACTTGCTGCAGAGCAGAAGGGG - Intronic
1171848174 20:30290508-30290530 CTGTTCCTGCAAAGGGCCAGGGG - Intergenic
1173175878 20:40764449-40764471 CAGTGGCTGGAGAGGACAAGTGG + Intergenic
1173983595 20:47243864-47243886 CTGTTGTTGCAGAGAACAATAGG - Intronic
1176257423 20:64159579-64159601 CTGTCCCTGCAGGGGACAGGTGG - Intronic
1176869704 21:14075040-14075062 CTGTTGTAGCAGAGGGCATGGGG + Intergenic
1177387892 21:20430739-20430761 CTGTTGGTGCTGAGCACAGGAGG + Intergenic
1178413903 21:32388368-32388390 CTGCTGCTGCTGAGGACACCCGG - Intronic
1179711811 21:43267917-43267939 CTGTACCTGCAGAGGACTTGAGG + Intergenic
1179797620 21:43794548-43794570 CAGTAGCAGCAGAGGACACGCGG - Intronic
1185310307 22:50150609-50150631 CTCTTGCTGCAGGGGACGACGGG - Intronic
1185327674 22:50235021-50235043 CTGATGCTGCCGTGGACAGGGGG - Intronic
949343224 3:3051657-3051679 CTGATGCTGCGGAGAAGAAGGGG + Intronic
950085414 3:10254157-10254179 CTGTTGTTGCCAAGGACAATCGG + Intronic
950883854 3:16345991-16346013 TTCTTGCTGCAGAGGAAGAGAGG - Intronic
951228262 3:20146026-20146048 CTTATGCTACAGATGACAAGTGG + Intronic
951337116 3:21436880-21436902 CTTTTGCAGCAGGGGACAAAGGG - Intronic
951720570 3:25693382-25693404 ATGTTCCTGCAAAGGACATGAGG + Intergenic
953270369 3:41436777-41436799 CCTGTGCTGCAGAGGACATGGGG - Intronic
955722314 3:61895754-61895776 CTGTTGCTGCAGATGAGAGTTGG + Intronic
955873243 3:63462052-63462074 CTGTGGCTGCAGTGGCCAAGAGG - Intronic
957068057 3:75542451-75542473 CTGTTGGTGCTGAGCATAAGAGG + Intergenic
957507392 3:81140610-81140632 CTGTATCTTCAGATGACAAGTGG - Intergenic
958074713 3:88661248-88661270 CTGTTGCTGTAGTGGTTAAGGGG - Intergenic
959487630 3:106945681-106945703 GTGCTGCTGCAGAGGAAGAGTGG - Intergenic
959957876 3:112259459-112259481 ATGTTGCTGCAAAGGACACGAGG - Intronic
960164051 3:114381792-114381814 CTGTTTCTTCAGAGGGCAGGAGG + Intronic
961677689 3:128577684-128577706 CTGTTGGGGCAGAGGGCAGGTGG - Intergenic
963139071 3:141932865-141932887 CTGTGGGTGCAGAGAATAAGAGG + Intergenic
964182939 3:153909433-153909455 CTGCTTCTTCAGAAGACAAGAGG + Intergenic
964670074 3:159215276-159215298 CTGTCTCTGAAGAGGAAAAGAGG - Intronic
966423951 3:179761095-179761117 CTGATGCTACAGAGCACAACAGG - Exonic
966761005 3:183419077-183419099 CTGTAGGTGCACAGAACAAGAGG - Intronic
967166946 3:186789172-186789194 TTGTTACTGAAGAAGACAAGAGG + Exonic
967890911 3:194363970-194363992 GTGTGGCTTCAGAGGTCAAGCGG + Intronic
969266137 4:6065275-6065297 CTGGTGCTCCAGGGGCCAAGTGG - Intronic
969702280 4:8774142-8774164 CTGGGGCTGCAAAGGACCAGAGG - Intergenic
969800808 4:9563627-9563649 CTGTTGGTGCTGAGCATAAGAGG - Intergenic
969853209 4:9978145-9978167 CTGTTACTGAAGAGGACACTGGG + Intronic
970278952 4:14433046-14433068 CCTCTGCTGCAGAGGACCAGTGG - Intergenic
971028818 4:22614598-22614620 CTGTTGCTGCAGGAGTGAAGAGG - Intergenic
972630443 4:40837256-40837278 CTGTTGCTGCATGGGACACGGGG + Intronic
973710646 4:53627062-53627084 AGGAAGCTGCAGAGGACAAGAGG - Intronic
975293197 4:72701542-72701564 CTGTTGGGGGAGAGGAAAAGAGG - Intergenic
975389814 4:73802897-73802919 CTGTAGCAGCAGTGGAAAAGGGG - Intergenic
977198698 4:94089709-94089731 CTGATGGAGCAAAGGACAAGAGG + Intergenic
977874739 4:102135648-102135670 CTGGGGCTGCAGAGGACCAGCGG - Intergenic
982010656 4:151102974-151102996 CTGTTGGTGCTGAGCATAAGAGG - Exonic
982540678 4:156666230-156666252 CTGCTGTTCCAGAGGACAGGAGG + Intergenic
983674666 4:170278763-170278785 CTGTACCTGGAGAGGAGAAGTGG - Intergenic
984202497 4:176742892-176742914 CAGGTGCTGGAGAAGACAAGTGG + Intronic
985401878 4:189601064-189601086 CTGGTGTTGCAGAGGAGACGTGG - Intergenic
986040333 5:3988117-3988139 AAGTTGCTGGAGAGGATAAGGGG - Intergenic
986302181 5:6486424-6486446 CTGTGGTGGGAGAGGACAAGGGG - Intronic
986903607 5:12467579-12467601 CTGCTGCTGCAGAGCACAGGGGG + Intergenic
987996631 5:25290476-25290498 GTGAGGCTGCAGAGGAAAAGGGG + Intergenic
988693528 5:33596233-33596255 CTGATGCTGCAGCTGGCAAGAGG + Intronic
990010878 5:50995769-50995791 CTGGTGCTACTGAGGCCAAGGGG - Intergenic
990481436 5:56215169-56215191 TTGTTGCTGCATAGAACAAATGG + Intronic
991149020 5:63344505-63344527 CTGCTGCTGCTGTAGACAAGAGG + Intergenic
993477428 5:88382394-88382416 CTGTTGGTGCTGAGCATAAGAGG - Intergenic
995352260 5:111192563-111192585 CTGTTGGTGCTGAGCATAAGAGG + Intergenic
997787010 5:136722858-136722880 CTGTACCTGCTGAGGCCAAGTGG + Intergenic
999110949 5:149121154-149121176 CTGTTGCTGCTCAGGTCACGGGG - Intergenic
999948142 5:156619644-156619666 CTTTTCCAGCAGAGGCCAAGGGG + Intronic
1000581619 5:163041107-163041129 CTGATGCTGCAGTGGACTTGGGG + Intergenic
1000654042 5:163854442-163854464 CAGTTGCTGGAGAGGATATGGGG + Intergenic
1001117960 5:168955435-168955457 CTGTTGGTGGTGAGGAAAAGAGG - Intronic
1002161971 5:177319587-177319609 TTGTTGCTACAGAGAACAATAGG + Intergenic
1002716140 5:181229116-181229138 CAGTTGCTGCACAGGATAAGTGG - Intronic
1003033625 6:2623791-2623813 ATGTTCCTGAAGAGGTCAAGTGG + Exonic
1006415424 6:33900871-33900893 CTGTTGCTGCAGATGCCACGAGG + Intergenic
1006831187 6:36969227-36969249 CTCTTGCTTCAGAGCCCAAGTGG + Intronic
1008492147 6:52097521-52097543 CTGATGCTGCAGAGAATATGAGG - Intergenic
1009026794 6:58009810-58009832 CTGATGCTTCAGAGAACTAGAGG + Intergenic
1009242426 6:61198628-61198650 CTGATGCTGCACAGAACAGGGGG - Intergenic
1011254352 6:85405693-85405715 TTCTTGCTGAAGAGAACAAGTGG - Intergenic
1012507026 6:99958971-99958993 CTGCTGCTCCAGAGGACCTGTGG + Intronic
1012898308 6:104977258-104977280 CTGTTTGTGCAAAGGAAAAGTGG - Intronic
1014964263 6:127727450-127727472 CAGTTGCTGCAGATGACAGATGG + Intronic
1016152654 6:140761983-140762005 CTGTTGGTGCTGAGAATAAGAGG - Intergenic
1016268253 6:142257431-142257453 CTGTTGCTTCATAGCACAAGTGG + Intergenic
1018213220 6:161502480-161502502 ATGTTGCTTCAGAAGAGAAGGGG - Intronic
1023614054 7:42000509-42000531 CTTTTCTTGCTGAGGACAAGGGG + Intronic
1023746327 7:43326112-43326134 CTGTTTCTGCGTAGGACCAGAGG + Intronic
1024286626 7:47763369-47763391 CTCTTGCTACAGAGGACATCTGG - Intronic
1027779454 7:82503980-82504002 CTGCTGCAGCAGAGGAAGAGAGG - Intergenic
1028232426 7:88321206-88321228 CTGTGGCTGCAGCTGACAAGGGG - Intergenic
1028777484 7:94695340-94695362 CTGTTGGTGCTGAGCATAAGAGG + Intergenic
1029137708 7:98386109-98386131 CTGTTGGTGCTGAGCATAAGAGG + Intronic
1029849272 7:103445831-103445853 GTGGAGCTGCAGAGGGCAAGGGG + Intronic
1029853299 7:103487251-103487273 CTGTTGGGGCAGGGGGCAAGGGG + Intronic
1031689022 7:124765593-124765615 CTACTGCTGCCGAGGAGAAGCGG + Exonic
1032488252 7:132304797-132304819 GGGTTGCAGCAGAGGACAGGGGG - Intronic
1034255448 7:149722399-149722421 CTGTTGCAGGAGAAGACAAGAGG - Intronic
1034278874 7:149838180-149838202 CCCTTGCTGCAGAGGACTAAAGG + Intergenic
1036218918 8:6904074-6904096 CTGTTGCTGTGGAGGTCAAATGG + Intergenic
1036254155 8:7191085-7191107 CTGTTGGTGCTGAGCATAAGAGG + Intergenic
1036363338 8:8096402-8096424 CTGTTGGTGCTGAGCATAAGAGG - Intergenic
1036895216 8:12628778-12628800 CTGTTGGTGCTGAGCATAAGAGG + Intergenic
1038084560 8:24180354-24180376 CTGTTCCAGCAGAGGTCTAGGGG + Intergenic
1041011850 8:53551439-53551461 CTGAAGCTGATGAGGACAAGGGG - Intergenic
1043428433 8:80171459-80171481 GGGGTGCTGCAGAGGACACGAGG - Intronic
1046517070 8:115276408-115276430 CTGTCGCTCCAGAGGACTGGTGG + Intergenic
1047251510 8:123184719-123184741 CTGCTGCTGCAGAGGGGCAGGGG + Intronic
1048580934 8:135729341-135729363 CTCATGCTGCAGAGGTCAATGGG + Intergenic
1048640231 8:136349541-136349563 GTTTTGCTACTGAGGACAAGAGG - Intergenic
1049522767 8:143102765-143102787 CTGCTGCAGCAGAGCCCAAGGGG - Intergenic
1049558172 8:143294007-143294029 CTGTGGCAGCAGAGGAGAAGCGG - Intronic
1050167321 9:2779025-2779047 CTGTTGCTAGAGAGTTCAAGGGG - Intronic
1053024447 9:34718520-34718542 CTGTCCCTGCAGAGGACACAGGG + Intergenic
1053302806 9:36963804-36963826 CTTGTGCTGCAGAGGCCAGGTGG + Intronic
1054916155 9:70497020-70497042 CAGTTGCTGAAGAACACAAGGGG - Intergenic
1055661043 9:78504457-78504479 CTGTTGCTGGATTGGACTAGTGG - Intergenic
1055829391 9:80360475-80360497 CTGCTGCTGCAGAGGGTGAGTGG + Intergenic
1055869526 9:80857511-80857533 ATGTTGCTGGAGAAGACAAAAGG + Intergenic
1056581466 9:87890106-87890128 CTGTGGAGGCTGAGGACAAGGGG + Intergenic
1057569194 9:96190954-96190976 GTGTGGCTGGAGAGGACAAGTGG - Intergenic
1059053282 9:110952401-110952423 CTGTAGCTGCTTAGGACTAGAGG - Intronic
1059496681 9:114715680-114715702 CTGGTGTTGAAGAGGACATGGGG + Intergenic
1059927262 9:119222395-119222417 CAGTTGCTACAGAGAACATGCGG + Intronic
1062156143 9:135049739-135049761 CTGTGGCTGCTGAGGCCCAGGGG - Intergenic
1185473366 X:398407-398429 CTGTGGTTTCAGAGCACAAGTGG + Intergenic
1185883972 X:3765332-3765354 CTGTTGCTACAGAGACCACGTGG - Intergenic
1186420777 X:9424340-9424362 TTGGTGCTGCAGAGAACAGGGGG + Intergenic
1187871268 X:23767024-23767046 CTGTTCCTGCAGAGGAGTACCGG + Intergenic
1188951104 X:36376317-36376339 CTGCTGCTTCAGAGGACTAATGG - Intronic
1189280512 X:39817523-39817545 CTCTGGCTGCAGAGGGCATGAGG + Intergenic
1190681845 X:52832774-52832796 TTGTTACTGAAGAAGACAAGAGG - Intergenic
1197504858 X:127289134-127289156 CTGGGGTTGCAGAGGCCAAGTGG - Intergenic
1197569563 X:128132052-128132074 CTGTTCCTGCAGAGCAACAGGGG + Intergenic
1198329460 X:135608446-135608468 CTGTTGGAGCAGTTGACAAGGGG - Intergenic
1199636326 X:149815964-149815986 CTGATGCTGCTGAGGTCATGAGG + Intergenic
1199988596 X:152970549-152970571 CTGGCACTGCAAAGGACAAGTGG + Intronic