ID: 1132395290

View in Genome Browser
Species Human (GRCh38)
Location 15:101468652-101468674
Sequence ACCAACTGCTGTCTCCTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 224}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132395290_1132395292 -10 Left 1132395290 15:101468652-101468674 CCATGAAGGAGACAGCAGTTGGT 0: 1
1: 0
2: 0
3: 18
4: 224
Right 1132395292 15:101468665-101468687 AGCAGTTGGTACTAATAACTGGG 0: 1
1: 0
2: 1
3: 9
4: 96
1132395290_1132395293 -5 Left 1132395290 15:101468652-101468674 CCATGAAGGAGACAGCAGTTGGT 0: 1
1: 0
2: 0
3: 18
4: 224
Right 1132395293 15:101468670-101468692 TTGGTACTAATAACTGGGAGTGG 0: 1
1: 0
2: 0
3: 17
4: 168
1132395290_1132395298 25 Left 1132395290 15:101468652-101468674 CCATGAAGGAGACAGCAGTTGGT 0: 1
1: 0
2: 0
3: 18
4: 224
Right 1132395298 15:101468700-101468722 CGTCCTTGATGCTGGGCCAGTGG 0: 1
1: 0
2: 1
3: 13
4: 107
1132395290_1132395296 18 Left 1132395290 15:101468652-101468674 CCATGAAGGAGACAGCAGTTGGT 0: 1
1: 0
2: 0
3: 18
4: 224
Right 1132395296 15:101468693-101468715 CCATCCACGTCCTTGATGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 71
1132395290_1132395294 17 Left 1132395290 15:101468652-101468674 CCATGAAGGAGACAGCAGTTGGT 0: 1
1: 0
2: 0
3: 18
4: 224
Right 1132395294 15:101468692-101468714 GCCATCCACGTCCTTGATGCTGG 0: 1
1: 0
2: 0
3: 3
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132395290 Original CRISPR ACCAACTGCTGTCTCCTTCA TGG (reversed) Intronic