ID: 1132395298 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:101468700-101468722 |
Sequence | CGTCCTTGATGCTGGGCCAG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 122 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 13, 4: 107} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1132395290_1132395298 | 25 | Left | 1132395290 | 15:101468652-101468674 | CCATGAAGGAGACAGCAGTTGGT | 0: 1 1: 0 2: 0 3: 18 4: 224 |
||
Right | 1132395298 | 15:101468700-101468722 | CGTCCTTGATGCTGGGCCAGTGG | 0: 1 1: 0 2: 1 3: 13 4: 107 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1132395298 | Original CRISPR | CGTCCTTGATGCTGGGCCAG TGG | Intronic | ||