ID: 1132395298

View in Genome Browser
Species Human (GRCh38)
Location 15:101468700-101468722
Sequence CGTCCTTGATGCTGGGCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132395290_1132395298 25 Left 1132395290 15:101468652-101468674 CCATGAAGGAGACAGCAGTTGGT 0: 1
1: 0
2: 0
3: 18
4: 224
Right 1132395298 15:101468700-101468722 CGTCCTTGATGCTGGGCCAGTGG 0: 1
1: 0
2: 1
3: 13
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132395298 Original CRISPR CGTCCTTGATGCTGGGCCAG TGG Intronic