ID: 1132396623

View in Genome Browser
Species Human (GRCh38)
Location 15:101479579-101479601
Sequence CGGTGCATGCAGAGGCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132396616_1132396623 6 Left 1132396616 15:101479550-101479572 CCCAGAGGCTGGTCGGACAGGGC 0: 1
1: 0
2: 1
3: 11
4: 108
Right 1132396623 15:101479579-101479601 CGGTGCATGCAGAGGCTGGTGGG 0: 1
1: 0
2: 1
3: 9
4: 171
1132396617_1132396623 5 Left 1132396617 15:101479551-101479573 CCAGAGGCTGGTCGGACAGGGCT 0: 1
1: 0
2: 0
3: 9
4: 159
Right 1132396623 15:101479579-101479601 CGGTGCATGCAGAGGCTGGTGGG 0: 1
1: 0
2: 1
3: 9
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132396623 Original CRISPR CGGTGCATGCAGAGGCTGGT GGG Intronic
900302507 1:1985227-1985249 CGGTGAATGCAGTGGTTGGAAGG - Intronic
901053684 1:6438587-6438609 CTGTGCATGCAGGGCCTGGCCGG - Intronic
901089139 1:6629838-6629860 CGGTGCTTCCAGTGCCTGGTTGG + Intronic
902480620 1:16709744-16709766 CTGTGCATGCAGGGCCTGGCTGG + Intergenic
902975322 1:20084257-20084279 CTTTGCAGGCAGAGGCTGGGCGG - Intronic
904615156 1:31745619-31745641 CTGCTCATGCAGAGGCTGCTGGG - Intronic
907316257 1:53574631-53574653 CTCTGCCTGGAGAGGCTGGTGGG + Intronic
907372309 1:54011386-54011408 GGATGCAAGCAGAGGCTGGGTGG + Intronic
910969492 1:92841194-92841216 TGGTGGTTACAGAGGCTGGTGGG - Intronic
911088636 1:94000567-94000589 GGATGCATGCAGAGCCTGGCTGG - Intronic
912387043 1:109276136-109276158 GGCTGCATTGAGAGGCTGGTTGG + Intergenic
912459669 1:109822319-109822341 CGGTCCAATCAGAGGGTGGTGGG + Intergenic
914463915 1:147909356-147909378 CTGTCCAACCAGAGGCTGGTGGG - Intergenic
920179145 1:204121969-204121991 CGGTACCTGCAGGGGGTGGTGGG - Exonic
924708929 1:246518753-246518775 AGGTGCAGGGAGAGGCAGGTGGG - Intergenic
1062970392 10:1643709-1643731 AGCTGCATGCGGAGGCTGGAAGG - Intronic
1069565531 10:69461082-69461104 CCGTTCATGCAGATGCTGGGAGG + Intronic
1070240497 10:74675403-74675425 CGATGCTTGTAGAGGCTGGAGGG - Intronic
1075392993 10:122106374-122106396 GGGTGATTGCAGATGCTGGTGGG + Intronic
1078039652 11:7848084-7848106 CAATGAATGCACAGGCTGGTAGG - Intergenic
1080058713 11:27934174-27934196 CCGTGACTGCAGGGGCTGGTAGG + Intergenic
1080250495 11:30228333-30228355 TGGTGGGTGCAGATGCTGGTGGG - Intergenic
1080250517 11:30228399-30228421 TGGTGGGTGCAGATGCTGGTAGG - Intergenic
1081665532 11:44915082-44915104 CTGTCCAGGCCGAGGCTGGTGGG + Intronic
1082899322 11:58228424-58228446 CTGTGCACGCAGATGCTGGGTGG - Exonic
1082904596 11:58292325-58292347 CTGTGCGTGCAGATGCTGGGCGG - Intergenic
1083275460 11:61594626-61594648 GTGTGGGTGCAGAGGCTGGTGGG + Intergenic
1083886462 11:65575856-65575878 CGGTGCGCGCAGAGGCTGCGTGG - Intergenic
1085200831 11:74701006-74701028 GCGTGCAAGCAGGGGCTGGTGGG - Intronic
1085246253 11:75103958-75103980 GTGTGGGTGCAGAGGCTGGTAGG - Intronic
1090518431 11:127452906-127452928 AGGTCCATGCTGAGACTGGTAGG - Intergenic
1091306333 11:134538643-134538665 CTGTGCATGGAGAAGCAGGTTGG + Intergenic
1096741092 12:53694848-53694870 CGGTGCCTGGAGAGGTGGGTTGG + Intergenic
1096787268 12:54024347-54024369 CGGTGCCTCCTGAGGCTGCTCGG - Intronic
1098487777 12:71041486-71041508 TGCTGGAGGCAGAGGCTGGTGGG - Intergenic
1104808883 12:131608031-131608053 CTTTGCATGCAGTGGCTGGTCGG + Intergenic
1104896481 12:132167352-132167374 CTGTGCGTGCTGAGGCTGTTGGG + Intergenic
1107001918 13:35557482-35557504 CAGAGCATGCAGACTCTGGTGGG + Intronic
1111160207 13:84384524-84384546 TGGTGCATGCAGGTGCTGATGGG - Intergenic
1111608765 13:90576425-90576447 CAGTGCATGGAGCGGCTGGCTGG + Intergenic
1113711203 13:112466664-112466686 CTGTGCATGGAGAAGCTGGGAGG - Intergenic
1120376458 14:83713942-83713964 CAGTGAAGGCAGAGGATGGTGGG - Intergenic
1121533324 14:94673660-94673682 CCGTGCACACAAAGGCTGGTGGG + Intergenic
1121605515 14:95237313-95237335 CGGCACCTGCAGAGGCTGGGAGG + Intronic
1121873513 14:97430535-97430557 TGATGAAGGCAGAGGCTGGTGGG + Intergenic
1122060121 14:99131716-99131738 GTGTGCAGGCAGAGGCTGGAGGG + Intergenic
1122460290 14:101888915-101888937 AGATGCATGGAGAGGCTGGAAGG - Intronic
1122703680 14:103607079-103607101 AGGTGGAGGCAGAGGCTGGAGGG + Intronic
1122809329 14:104280294-104280316 GGCTCCAAGCAGAGGCTGGTGGG + Intergenic
1122881887 14:104693958-104693980 AGGTGGAAGCAGAGGCAGGTGGG - Intronic
1122921766 14:104883203-104883225 CGAAGGATGCAGAGGCAGGTGGG + Exonic
1122922871 14:104887163-104887185 CTGTGCCCGCAGAGGCTGGGGGG - Exonic
1123479097 15:20614723-20614745 GTGTTCATGTAGAGGCTGGTGGG - Intergenic
1123638915 15:22385662-22385684 GTGTTCATGTAGAGGCTGGTGGG + Intergenic
1128806153 15:70532697-70532719 AGGTGCAGGCAGAGGCATGTAGG - Intergenic
1129172867 15:73818440-73818462 CAGTGAATGCAGAGTGTGGTTGG - Intergenic
1129690905 15:77712774-77712796 GGGTGCAGGCCGAAGCTGGTGGG - Intronic
1130022813 15:80245258-80245280 AGGTGCCTGGTGAGGCTGGTTGG - Intergenic
1131314154 15:91318038-91318060 CTGTGGAAGCAGAGGCTGGAGGG - Intergenic
1131854872 15:96582870-96582892 CAGTGCAGGCAGGAGCTGGTGGG - Intergenic
1131946539 15:97628511-97628533 TGGTGCTTGCAGTGGCTGGATGG - Intergenic
1132080566 15:98861402-98861424 CGCTGCATGCAGAGGGTGTAAGG - Intronic
1132396623 15:101479579-101479601 CGGTGCATGCAGAGGCTGGTGGG + Intronic
1136989871 16:35145574-35145596 CGGTGCATGCTGGGACCGGTGGG - Intergenic
1139657709 16:68399105-68399127 AGGTGTAGGCAGAGGCTGGGCGG - Intronic
1141263572 16:82475571-82475593 CTGAGGATGCAGAGGCTGGCAGG - Intergenic
1142336882 16:89495147-89495169 CTGTGCACGCAGTTGCTGGTGGG - Intronic
1142399357 16:89851276-89851298 CAGGGCCTGGAGAGGCTGGTGGG - Intronic
1143874626 17:9982198-9982220 GGGTGAATGAAGAGGCAGGTTGG - Intronic
1148767615 17:50048336-50048358 CGGCGCATGCAGAGGTTGGGTGG + Intergenic
1151025502 17:70671834-70671856 CGGTCCATCCAGAGGCTCGAGGG - Intergenic
1152366714 17:79860612-79860634 CGGTGGAGACAGGGGCTGGTGGG + Intergenic
1153523734 18:5976456-5976478 GGGTGCAGGAAGAGGCTGGGTGG + Intronic
1156482481 18:37444991-37445013 AGGTGCAGACAGAGGCTGGGTGG + Intronic
1157267498 18:46240170-46240192 AGCTGAATGCAGAGGCAGGTTGG + Exonic
1160006409 18:75072234-75072256 CTGTGCATCCTGAGGCTAGTGGG + Intergenic
1160831179 19:1105528-1105550 CGGGGCCCGCAGAGGCGGGTGGG + Intronic
1161251206 19:3281256-3281278 CGGCGCATGCAGCAGATGGTGGG + Exonic
1162500225 19:11049179-11049201 CAGTGCATGCAGAGGCTGGAGGG + Intronic
1163806631 19:19403277-19403299 GGGTGAATGCTGAGGCTGTTTGG - Intronic
1164976932 19:32580756-32580778 CGGTGCACACAGAGGCCGGCCGG - Intergenic
1165742287 19:38211371-38211393 CCGTGCCTGCCGTGGCTGGTGGG - Intronic
1166417642 19:42607938-42607960 TGGTGCTTGCAGTGGCTGGGAGG - Intronic
1168283960 19:55321316-55321338 AGGTGCAAGGAGAGGCTGGGAGG - Intronic
1168575354 19:57504475-57504497 CTGAGCAAGCAGAGGCAGGTAGG - Intronic
1202714659 1_KI270714v1_random:35652-35674 CTGTGCATGCAGGGCCTGGCTGG + Intergenic
924960931 2:33849-33871 CCGTGCAGGCAGAGGCAGGAAGG - Intergenic
926575899 2:14580961-14580983 CGGTGGTTACAGAGGCTGGAGGG - Intergenic
930680829 2:54255489-54255511 CCGTGAATGCAGAGGCTGACAGG - Exonic
934053530 2:88231711-88231733 CAGTGGAGGCAGAGGCTGGTGGG + Intergenic
934077973 2:88443801-88443823 CGGGGGATGGAGAGGGTGGTGGG + Intergenic
935221722 2:101021065-101021087 TGGTGCCTGGGGAGGCTGGTAGG - Intronic
938296426 2:130182205-130182227 CGCTGCAGGGAGAGGGTGGTGGG + Exonic
944358707 2:198825261-198825283 CAGTGCTTGCATAGGCAGGTGGG - Intergenic
944692222 2:202168687-202168709 CACTGAATGCAGAGGCTGGAAGG - Intronic
945916721 2:215712065-215712087 CGCTGCATGGAGAGGAAGGTAGG - Intergenic
946703405 2:222434754-222434776 TGGTGAATGCACAGGCTGCTGGG + Intronic
948251870 2:236536003-236536025 AGGTGGGTGCAGAGGATGGTGGG + Intergenic
948871023 2:240798131-240798153 CTGTGGATGCAGGCGCTGGTGGG + Intronic
1173576562 20:44116022-44116044 CGGTGCCTGCAGAGCCTCGATGG + Exonic
1173754999 20:45508219-45508241 CTGTGCACGCAGATCCTGGTTGG - Intergenic
1175739706 20:61412079-61412101 TGGTGCCTGCAGAGGAGGGTTGG - Intronic
1175885541 20:62288384-62288406 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175885547 20:62288407-62288429 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175885565 20:62288475-62288497 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175885577 20:62288520-62288542 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175885589 20:62288565-62288587 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1178122575 21:29484158-29484180 GGCTGCATGTTGAGGCTGGTGGG + Intronic
1178389924 21:32189793-32189815 GGGTGGATGCAGAGGATGGCAGG - Intergenic
1178415412 21:32400898-32400920 TGGCTCATGCAGAGCCTGGTTGG + Intergenic
1178529302 21:33361845-33361867 CTGAACATGCAGAGGCTGCTGGG + Intergenic
1181411050 22:22719983-22720005 CGGTGCAGGAAGGGGCTGGAAGG + Intergenic
1181725888 22:24810647-24810669 GGGAGAATGCAGGGGCTGGTGGG + Intronic
1183368967 22:37421770-37421792 CTGTGCAGGCGGAGACTGGTAGG - Intronic
1183454092 22:37912145-37912167 CCATGCATGAGGAGGCTGGTGGG - Intronic
1184390149 22:44199144-44199166 AGGTGCATGGACAGGCAGGTAGG - Intronic
1184654420 22:45933975-45933997 CGGAACATTCAGAGGCCGGTCGG + Intronic
1184890081 22:47374116-47374138 AGGTGCAGGCAGAGGCAGGTGGG - Intergenic
1185046699 22:48532027-48532049 CTGTGCATCCAGAGGAAGGTGGG + Intronic
1185061591 22:48609859-48609881 TGGTGGAGGCAGAGGCTGGCGGG - Intronic
950320337 3:12046450-12046472 AGGTTCATGCAGAGGCTTATAGG + Intronic
951026909 3:17840317-17840339 GGGTGGGTGCAGATGCTGGTGGG + Intronic
952893272 3:38058808-38058830 CTGTGCATGCAGGGGCTGTATGG + Intronic
953561498 3:43996456-43996478 CGCTGAAGGCAAAGGCTGGTGGG + Intergenic
954472298 3:50708129-50708151 TGGTGCATGCAGGTGGTGGTGGG + Intronic
954807593 3:53229467-53229489 AGGGGCAGGCAGAGGGTGGTCGG + Intronic
955777312 3:62447708-62447730 GACTGCCTGCAGAGGCTGGTGGG + Intronic
957107340 3:75907081-75907103 CGGTGGCTGCACAGGCTGGGAGG + Intronic
961458981 3:127038339-127038361 GAGTTCATGGAGAGGCTGGTGGG - Intergenic
961585206 3:127916333-127916355 CTACGCTTGCAGAGGCTGGTAGG - Intronic
963716254 3:148807680-148807702 CGGAGGAGGCAGAGGCTGGAAGG + Intronic
968076853 3:195820693-195820715 CGATGGAGGCAGAGGCTGGAGGG - Intergenic
968607747 4:1543471-1543493 AGGTGCTTGCAGGGGCTGGAGGG + Intergenic
968630471 4:1648297-1648319 CGGTGCAGGCAGGGGTAGGTGGG + Intronic
969122249 4:4919197-4919219 GGGCATATGCAGAGGCTGGTGGG - Intergenic
969527581 4:7711798-7711820 CTATGCATGCACAGCCTGGTAGG - Intronic
969724234 4:8910051-8910073 GAGTGCAGACAGAGGCTGGTGGG - Intergenic
970572654 4:17398198-17398220 CTGGGCAGGCAGGGGCTGGTAGG + Intergenic
978328936 4:107590304-107590326 GGGTGCATGCATGGGATGGTTGG - Intronic
983998545 4:174214218-174214240 CGAAGCCTGAAGAGGCTGGTTGG + Intergenic
986269494 5:6218488-6218510 CCATGCATCCAGAGGCTGGGAGG - Intergenic
990976504 5:61565832-61565854 AGGAGCATGAAGAGGCTGGTAGG - Intergenic
994777279 5:104050141-104050163 CGGTGCTTGGAGTGGCTGGCCGG + Intergenic
998538771 5:142959544-142959566 CGCTGCCTCCAGAGGCTGGGAGG - Intronic
999217193 5:149945178-149945200 GGGGGGATGCAGAGGCTGGCAGG - Intergenic
1001919798 5:175590912-175590934 CCTTTCATGCAGAGGCTGCTAGG - Intergenic
1002916093 6:1529009-1529031 TGGTGGCTGCAGTGGCTGGTAGG - Intergenic
1003049524 6:2766487-2766509 CGGTGGATGCAGCTGATGGTCGG + Intronic
1007074280 6:39056908-39056930 CAGTCCATGCACAGGCTGGGAGG - Intronic
1018346021 6:162899962-162899984 CTGTGCATGCAGAGGATGAGGGG + Intronic
1019144953 6:169970559-169970581 CTGTGCCTGCAGAGGCAGGAGGG + Intergenic
1022471924 7:30687253-30687275 TGGTGGATGTAGAGGCTGCTAGG - Intronic
1024437529 7:49376815-49376837 AGGTGCATACACAGGATGGTTGG + Intergenic
1024439445 7:49398943-49398965 TGACTCATGCAGAGGCTGGTGGG + Intergenic
1028577024 7:92363475-92363497 CAGGGCATGCAGAGGCTAGAGGG + Intronic
1029372026 7:100156381-100156403 CAGAGCATGCACAGGCTGGTAGG - Exonic
1033461413 7:141550695-141550717 GGGTGCAATCAGGGGCTGGTGGG - Intergenic
1034325066 7:150222256-150222278 CTGTGGATGCAGATGCTGGTTGG + Intergenic
1034449095 7:151127959-151127981 CGCTGAACGCAGAGGCTGGATGG - Intronic
1034768135 7:153746993-153747015 CTGTAGATGCAGATGCTGGTTGG - Intergenic
1035777015 8:2196084-2196106 CCGGCCATGCAGAGGCTGGCGGG - Intergenic
1037395492 8:18437457-18437479 CGGTGGATGCACAGCCTGGTGGG - Intergenic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1039390752 8:37179300-37179322 CGTGGTAAGCAGAGGCTGGTTGG - Intergenic
1042325979 8:67528328-67528350 GCTTCCATGCAGAGGCTGGTTGG + Intronic
1044391346 8:91655663-91655685 TGGTGGTTGCAGGGGCTGGTGGG + Intergenic
1047338202 8:123955874-123955896 GGGTGGATGAGGAGGCTGGTGGG + Intronic
1049875778 8:145019416-145019438 TGGAGTCTGCAGAGGCTGGTAGG + Intergenic
1054766547 9:69047154-69047176 GGGTCCATGCAGATACTGGTTGG - Intronic
1057266723 9:93622257-93622279 CGGTGTATGGACAGGCTGGCTGG - Intronic
1057302997 9:93897104-93897126 TGGTGAATTCAGTGGCTGGTAGG + Intergenic
1060233126 9:121840342-121840364 CGATGGATGCACAGGCTGGAGGG + Intronic
1061119735 9:128635457-128635479 CGGTGCCTGCAGAGGAGGCTGGG + Intronic
1062185127 9:135214156-135214178 CAGGGCATGCTGAGGCTGCTGGG + Intergenic
1062579047 9:137221596-137221618 CGGGGCAGGCAGGGGCTGGGTGG + Intergenic
1186273804 X:7918757-7918779 CGGTGAAAGAAGTGGCTGGTGGG - Intronic
1186536538 X:10355835-10355857 TGGAGCATTCAGAGACTGGTAGG + Intergenic
1188861298 X:35259725-35259747 CAGTGCAGGAAGAGGCTGGTAGG - Intergenic
1192248159 X:69389769-69389791 CGGGGCATGAGGATGCTGGTTGG - Intergenic
1198405620 X:136309669-136309691 TGCTGCATGCAGAGCCTGATAGG + Intronic
1200098256 X:153674103-153674125 CGGTGAAGGCAGAGACTGGAAGG - Exonic
1201991440 Y:20031470-20031492 TGGAGCCTGCAGAGGCAGGTAGG - Intergenic