ID: 1132398463

View in Genome Browser
Species Human (GRCh38)
Location 15:101490303-101490325
Sequence TGCTGGGAGGCAGGCCGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 1, 1: 0, 2: 5, 3: 45, 4: 400}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132398454_1132398463 0 Left 1132398454 15:101490280-101490302 CCCATGGCGGAGGCCGCGGCCCA 0: 1
1: 0
2: 1
3: 8
4: 117
Right 1132398463 15:101490303-101490325 TGCTGGGAGGCAGGCCGTGCAGG 0: 1
1: 0
2: 5
3: 45
4: 400
1132398447_1132398463 21 Left 1132398447 15:101490259-101490281 CCGAGAAACCACCGCACGGAGCC 0: 1
1: 0
2: 0
3: 4
4: 207
Right 1132398463 15:101490303-101490325 TGCTGGGAGGCAGGCCGTGCAGG 0: 1
1: 0
2: 5
3: 45
4: 400
1132398449_1132398463 13 Left 1132398449 15:101490267-101490289 CCACCGCACGGAGCCCATGGCGG 0: 1
1: 0
2: 0
3: 8
4: 98
Right 1132398463 15:101490303-101490325 TGCTGGGAGGCAGGCCGTGCAGG 0: 1
1: 0
2: 5
3: 45
4: 400
1132398455_1132398463 -1 Left 1132398455 15:101490281-101490303 CCATGGCGGAGGCCGCGGCCCAT 0: 1
1: 0
2: 1
3: 6
4: 132
Right 1132398463 15:101490303-101490325 TGCTGGGAGGCAGGCCGTGCAGG 0: 1
1: 0
2: 5
3: 45
4: 400
1132398446_1132398463 22 Left 1132398446 15:101490258-101490280 CCCGAGAAACCACCGCACGGAGC 0: 1
1: 0
2: 0
3: 1
4: 66
Right 1132398463 15:101490303-101490325 TGCTGGGAGGCAGGCCGTGCAGG 0: 1
1: 0
2: 5
3: 45
4: 400
1132398451_1132398463 10 Left 1132398451 15:101490270-101490292 CCGCACGGAGCCCATGGCGGAGG 0: 1
1: 0
2: 0
3: 6
4: 139
Right 1132398463 15:101490303-101490325 TGCTGGGAGGCAGGCCGTGCAGG 0: 1
1: 0
2: 5
3: 45
4: 400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132398463 Original CRISPR TGCTGGGAGGCAGGCCGTGC AGG Intronic