ID: 1132403446

View in Genome Browser
Species Human (GRCh38)
Location 15:101527950-101527972
Sequence GTGTCTGCACACGTGTACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132403446_1132403453 -1 Left 1132403446 15:101527950-101527972 CCTGAGTACACGTGTGCAGACAC No data
Right 1132403453 15:101527972-101527994 CACCCCCAGATGGGGGCGAGGGG No data
1132403446_1132403449 -9 Left 1132403446 15:101527950-101527972 CCTGAGTACACGTGTGCAGACAC No data
Right 1132403449 15:101527964-101527986 TGCAGACACACCCCCAGATGGGG No data
1132403446_1132403451 -3 Left 1132403446 15:101527950-101527972 CCTGAGTACACGTGTGCAGACAC No data
Right 1132403451 15:101527970-101527992 CACACCCCCAGATGGGGGCGAGG No data
1132403446_1132403448 -10 Left 1132403446 15:101527950-101527972 CCTGAGTACACGTGTGCAGACAC No data
Right 1132403448 15:101527963-101527985 GTGCAGACACACCCCCAGATGGG No data
1132403446_1132403456 2 Left 1132403446 15:101527950-101527972 CCTGAGTACACGTGTGCAGACAC No data
Right 1132403456 15:101527975-101527997 CCCCAGATGGGGGCGAGGGGTGG No data
1132403446_1132403458 3 Left 1132403446 15:101527950-101527972 CCTGAGTACACGTGTGCAGACAC No data
Right 1132403458 15:101527976-101527998 CCCAGATGGGGGCGAGGGGTGGG No data
1132403446_1132403450 -8 Left 1132403446 15:101527950-101527972 CCTGAGTACACGTGTGCAGACAC No data
Right 1132403450 15:101527965-101527987 GCAGACACACCCCCAGATGGGGG No data
1132403446_1132403460 4 Left 1132403446 15:101527950-101527972 CCTGAGTACACGTGTGCAGACAC No data
Right 1132403460 15:101527977-101527999 CCAGATGGGGGCGAGGGGTGGGG No data
1132403446_1132403452 -2 Left 1132403446 15:101527950-101527972 CCTGAGTACACGTGTGCAGACAC No data
Right 1132403452 15:101527971-101527993 ACACCCCCAGATGGGGGCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132403446 Original CRISPR GTGTCTGCACACGTGTACTC AGG (reversed) Intergenic