ID: 1132403450

View in Genome Browser
Species Human (GRCh38)
Location 15:101527965-101527987
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132403443_1132403450 9 Left 1132403443 15:101527933-101527955 CCACAACCCTCTGGGCACCTGAG No data
Right 1132403450 15:101527965-101527987 GCAGACACACCCCCAGATGGGGG No data
1132403445_1132403450 2 Left 1132403445 15:101527940-101527962 CCTCTGGGCACCTGAGTACACGT No data
Right 1132403450 15:101527965-101527987 GCAGACACACCCCCAGATGGGGG No data
1132403446_1132403450 -8 Left 1132403446 15:101527950-101527972 CCTGAGTACACGTGTGCAGACAC No data
Right 1132403450 15:101527965-101527987 GCAGACACACCCCCAGATGGGGG No data
1132403444_1132403450 3 Left 1132403444 15:101527939-101527961 CCCTCTGGGCACCTGAGTACACG No data
Right 1132403450 15:101527965-101527987 GCAGACACACCCCCAGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132403450 Original CRISPR GCAGACACACCCCCAGATGG GGG Intergenic