ID: 1132405431

View in Genome Browser
Species Human (GRCh38)
Location 15:101539305-101539327
Sequence GGAACTTGGTTGTGTGCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132405431_1132405438 21 Left 1132405431 15:101539305-101539327 CCCATTGCACACAACCAAGTTCC No data
Right 1132405438 15:101539349-101539371 GGTTTTATGCCACTCTGTTTTGG No data
1132405431_1132405435 -3 Left 1132405431 15:101539305-101539327 CCCATTGCACACAACCAAGTTCC No data
Right 1132405435 15:101539325-101539347 TCCTCTCATAGGATAATAGATGG No data
1132405431_1132405439 22 Left 1132405431 15:101539305-101539327 CCCATTGCACACAACCAAGTTCC No data
Right 1132405439 15:101539350-101539372 GTTTTATGCCACTCTGTTTTGGG No data
1132405431_1132405440 23 Left 1132405431 15:101539305-101539327 CCCATTGCACACAACCAAGTTCC No data
Right 1132405440 15:101539351-101539373 TTTTATGCCACTCTGTTTTGGGG No data
1132405431_1132405437 0 Left 1132405431 15:101539305-101539327 CCCATTGCACACAACCAAGTTCC No data
Right 1132405437 15:101539328-101539350 TCTCATAGGATAATAGATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132405431 Original CRISPR GGAACTTGGTTGTGTGCAAT GGG (reversed) Intergenic
No off target data available for this crispr