ID: 1132406290

View in Genome Browser
Species Human (GRCh38)
Location 15:101543381-101543403
Sequence CAAGGGAAGCGGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132406290_1132406299 10 Left 1132406290 15:101543381-101543403 CCTTCCTCCTTCCGCTTCCCTTG No data
Right 1132406299 15:101543414-101543436 TTCGGTACCTTTACCAAACCAGG No data
1132406290_1132406300 13 Left 1132406290 15:101543381-101543403 CCTTCCTCCTTCCGCTTCCCTTG No data
Right 1132406300 15:101543417-101543439 GGTACCTTTACCAAACCAGGTGG No data
1132406290_1132406294 -8 Left 1132406290 15:101543381-101543403 CCTTCCTCCTTCCGCTTCCCTTG No data
Right 1132406294 15:101543396-101543418 TTCCCTTGCTCTCCTGCCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132406290 Original CRISPR CAAGGGAAGCGGAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr