ID: 1132408358

View in Genome Browser
Species Human (GRCh38)
Location 15:101558724-101558746
Sequence AAATCAGGGTGCCGCCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132408346_1132408358 28 Left 1132408346 15:101558673-101558695 CCAAGAGGTGTCCCTCGAACCAG No data
Right 1132408358 15:101558724-101558746 AAATCAGGGTGCCGCCAGAGGGG No data
1132408351_1132408358 -6 Left 1132408351 15:101558707-101558729 CCAAGAGATACCCTTAGAAATCA No data
Right 1132408358 15:101558724-101558746 AAATCAGGGTGCCGCCAGAGGGG No data
1132408348_1132408358 17 Left 1132408348 15:101558684-101558706 CCCTCGAACCAGGTCACGTGATG No data
Right 1132408358 15:101558724-101558746 AAATCAGGGTGCCGCCAGAGGGG No data
1132408350_1132408358 9 Left 1132408350 15:101558692-101558714 CCAGGTCACGTGATGCCAAGAGA No data
Right 1132408358 15:101558724-101558746 AAATCAGGGTGCCGCCAGAGGGG No data
1132408349_1132408358 16 Left 1132408349 15:101558685-101558707 CCTCGAACCAGGTCACGTGATGC No data
Right 1132408358 15:101558724-101558746 AAATCAGGGTGCCGCCAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132408358 Original CRISPR AAATCAGGGTGCCGCCAGAG GGG Intergenic
No off target data available for this crispr