ID: 1132411487

View in Genome Browser
Species Human (GRCh38)
Location 15:101581465-101581487
Sequence GAACACTCCTAGACCATGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 65}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132411487_1132411488 26 Left 1132411487 15:101581465-101581487 CCTGTCATGGTCTAGGAGTGTTC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1132411488 15:101581514-101581536 TCTTGATGTGCATGATTTTGTGG 0: 1
1: 13
2: 16
3: 25
4: 254
1132411487_1132411490 28 Left 1132411487 15:101581465-101581487 CCTGTCATGGTCTAGGAGTGTTC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1132411490 15:101581516-101581538 TTGATGTGCATGATTTTGTGGGG 0: 1
1: 11
2: 17
3: 184
4: 934
1132411487_1132411491 29 Left 1132411487 15:101581465-101581487 CCTGTCATGGTCTAGGAGTGTTC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1132411491 15:101581517-101581539 TGATGTGCATGATTTTGTGGGGG 0: 1
1: 0
2: 1
3: 25
4: 222
1132411487_1132411489 27 Left 1132411487 15:101581465-101581487 CCTGTCATGGTCTAGGAGTGTTC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1132411489 15:101581515-101581537 CTTGATGTGCATGATTTTGTGGG 0: 1
1: 9
2: 10
3: 27
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132411487 Original CRISPR GAACACTCCTAGACCATGAC AGG (reversed) Intergenic
901033441 1:6321999-6322021 GGACACCCCTAGACCCTGGCAGG + Intronic
904438010 1:30511859-30511881 GGCCCCTCCTAGACCATGCCTGG - Intergenic
915500250 1:156311059-156311081 GAAAAATCCAAGGCCATGACTGG - Exonic
918259563 1:182783249-182783271 CAGCACTCCAAGACCATGCCAGG - Intergenic
1069940535 10:71952325-71952347 GAACACTCCCAGGGCAGGACTGG - Intergenic
1070268019 10:74923594-74923616 GAACACTCCTTCTCCATGCCTGG - Intronic
1075787683 10:125061161-125061183 AAACATTCCTAGACAATGCCAGG - Intronic
1078275427 11:9840287-9840309 GAAGACTCTTACACCAAGACAGG + Intronic
1092677040 12:10931408-10931430 GAACACTCCTTGTTCAGGACAGG + Intronic
1107898046 13:44985805-44985827 GAACACTTAGAGACCATGATAGG - Intronic
1118512014 14:66485511-66485533 GAACACCCCTAGAAAATGGCTGG + Intergenic
1119868163 14:77991363-77991385 GATCACTCCTGGACCAGGAATGG - Intergenic
1122601677 14:102924672-102924694 CAACACTCCAAGAACATGATGGG + Intronic
1127394086 15:58529670-58529692 GAAGAGTCCTAGAACATGGCAGG + Intronic
1132411487 15:101581465-101581487 GAACACTCCTAGACCATGACAGG - Intergenic
1133770336 16:8863930-8863952 GGACACTCCAAGGCCATGCCTGG - Intronic
1138040427 16:53658966-53658988 GAACAATACTAGATCAAGACTGG - Intronic
1146669054 17:34724317-34724339 GTACACTCGTAGACCATCAAGGG + Intergenic
1147185243 17:38709806-38709828 GAAGCCTCCTAGACTCTGACAGG - Intronic
1148866630 17:50632178-50632200 GAAGCCTCCTAGCCCAGGACTGG + Intergenic
1158945517 18:62444012-62444034 GAACAGACCTAGACCCAGACCGG - Intergenic
1162234687 19:9299070-9299092 GAAAACTCCTAGAAGATAACAGG + Intronic
1163770327 19:19187125-19187147 GGTCACTCCTGGCCCATGACAGG + Intronic
1168338355 19:55609677-55609699 GCACAGTCCTGTACCATGACTGG - Intronic
930709647 2:54538341-54538363 CATCACTCTTAGAGCATGACAGG + Intronic
932367596 2:71162899-71162921 GAAGCCCCCTAGACCATCACAGG - Intergenic
940143418 2:150521111-150521133 GAATGGTCCTAGACCACGACTGG + Intronic
947407908 2:229799842-229799864 GCACACCTCTAGAACATGACTGG - Intronic
1170967051 20:21082927-21082949 GAAGTTTCCTAGACCAGGACAGG + Intergenic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1173878670 20:46393978-46394000 GAGCACTCCTACACCTTGAGGGG - Intronic
1174468945 20:50741205-50741227 GAACACTTCGAGGCCAAGACGGG - Intronic
1178165953 21:29977260-29977282 GAAAAATCCTAAACAATGACTGG + Intergenic
1181469918 22:23131954-23131976 CAACAATCCTAGACCCTCACAGG + Intronic
1181791083 22:25267056-25267078 GAATATTCACAGACCATGACGGG + Intergenic
951973606 3:28476993-28477015 GACCAGTACTAGTCCATGACCGG - Intronic
953433143 3:42856066-42856088 GGACACTCCTAGCACATGGCTGG - Intronic
953932808 3:47014326-47014348 GGGCCCCCCTAGACCATGACTGG - Intergenic
954711309 3:52506349-52506371 GGACACTGCTAGGCCATGGCGGG + Intronic
956760590 3:72440201-72440223 GAACATTACTAGAACATTACCGG - Intronic
961219113 3:125186010-125186032 GAACACCCCTGGACAAAGACAGG - Intronic
961820730 3:129574472-129574494 GCACAGTTATAGACCATGACTGG + Exonic
962160665 3:132996418-132996440 GAACACTCCTAGACCATCCAGGG - Intergenic
963104892 3:141638727-141638749 GAAGACTTCCACACCATGACGGG + Intergenic
963507383 3:146204041-146204063 GAACACTCAGAGGCCATCACAGG + Intronic
967166822 3:186787542-186787564 GAACACGACTTGACCCTGACCGG - Exonic
992290349 5:75273088-75273110 GGACACACTCAGACCATGACAGG - Intergenic
992900039 5:81285690-81285712 GAAAAGTCCTAGACCAAGAAAGG + Intergenic
995321592 5:110840602-110840624 CAGCACTCCTAGTCCAGGACTGG + Intergenic
996675269 5:126167981-126168003 GCAATCTCCTAGACCCTGACTGG + Intergenic
999001638 5:147930071-147930093 GAACACTGTTGGACCATCACAGG + Intergenic
1000796754 5:165673662-165673684 AAACACCACTAGACCTTGACTGG + Intergenic
1000991896 5:167919814-167919836 GAACACTCTTAGAGGAAGACGGG + Intronic
1012186038 6:96218217-96218239 GAAGAGTCCTAGAACATGACTGG + Intergenic
1014168202 6:118249425-118249447 AAACACTTCTACACCTTGACTGG + Intronic
1024657138 7:51460344-51460366 GCACACTACTAGGCCATGCCTGG - Intergenic
1025159808 7:56646688-56646710 AACCACTCCTAGACTATGGCTGG - Intergenic
1025706191 7:63866484-63866506 GACCACTTCTGGACCATGGCTGG + Intergenic
1034329977 7:150273961-150273983 GAACACTCCTGGCCCATGCGAGG - Intronic
1034668080 7:152835899-152835921 GAACACTCCTGGCCCATGCGAGG + Intronic
1044987899 8:97771145-97771167 GAACTCTCCTTGTCCATTACTGG - Intergenic
1046002130 8:108433885-108433907 GAACACTTATACACCATTACTGG + Intronic
1047144922 8:122187620-122187642 GAACACTCATATACCCTGATAGG + Intergenic
1186304077 X:8235272-8235294 GAACACTCAGAGGCCATTACAGG + Intergenic
1187799509 X:23045014-23045036 GGACTCTCCTAGACCATGCCAGG + Intergenic
1187799772 X:23048383-23048405 GAACACTCCTATACAGTGATTGG - Intergenic
1190069535 X:47268245-47268267 GAATTCTCCTAGACCAAGACAGG + Intergenic
1190077296 X:47326823-47326845 GAATTCTCCTAGACCAAGACAGG - Intergenic
1192728515 X:73778260-73778282 GACTACTCCTGGACCATGATTGG + Intergenic
1194487893 X:94508888-94508910 GTAAATTCCTACACCATGACAGG - Intergenic
1198508587 X:137326516-137326538 AATGACTCCTAGAACATGACAGG + Intergenic