ID: 1132413078

View in Genome Browser
Species Human (GRCh38)
Location 15:101600205-101600227
Sequence CAGTGTCAGCAGAGGCCACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132413078_1132413085 -10 Left 1132413078 15:101600205-101600227 CCACGTGGCCTCTGCTGACACTG No data
Right 1132413085 15:101600218-101600240 GCTGACACTGCAGGTGGGAGGGG No data
1132413078_1132413086 -9 Left 1132413078 15:101600205-101600227 CCACGTGGCCTCTGCTGACACTG No data
Right 1132413086 15:101600219-101600241 CTGACACTGCAGGTGGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132413078 Original CRISPR CAGTGTCAGCAGAGGCCACG TGG (reversed) Intergenic
No off target data available for this crispr