ID: 1132415018

View in Genome Browser
Species Human (GRCh38)
Location 15:101613447-101613469
Sequence TCACCAGTGACTGCTGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132415018_1132415021 -8 Left 1132415018 15:101613447-101613469 CCTGGCCCAGCAGTCACTGGTGA No data
Right 1132415021 15:101613462-101613484 ACTGGTGAGACACCCAGCCCTGG No data
1132415018_1132415027 20 Left 1132415018 15:101613447-101613469 CCTGGCCCAGCAGTCACTGGTGA No data
Right 1132415027 15:101613490-101613512 TCTGTTCCTAATTCCCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132415018 Original CRISPR TCACCAGTGACTGCTGGGCC AGG (reversed) Intergenic
No off target data available for this crispr