ID: 1132416326

View in Genome Browser
Species Human (GRCh38)
Location 15:101622015-101622037
Sequence TTGGAATAACTGGGAAACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132416321_1132416326 1 Left 1132416321 15:101621991-101622013 CCAAGTGTGGCCTAGGATGTAAG 0: 1
1: 0
2: 0
3: 9
4: 97
Right 1132416326 15:101622015-101622037 TTGGAATAACTGGGAAACTCAGG 0: 1
1: 0
2: 0
3: 20
4: 150
1132416323_1132416326 -9 Left 1132416323 15:101622001-101622023 CCTAGGATGTAAGTTTGGAATAA 0: 1
1: 0
2: 2
3: 26
4: 281
Right 1132416326 15:101622015-101622037 TTGGAATAACTGGGAAACTCAGG 0: 1
1: 0
2: 0
3: 20
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132416326 Original CRISPR TTGGAATAACTGGGAAACTC AGG Intronic
901409160 1:9070981-9071003 TTGAAATAATTGGAAACCTCTGG - Intronic
908886932 1:68800051-68800073 TTGAAATAACTTGCAAAATCGGG - Intergenic
910654621 1:89607186-89607208 TTGGAATAACATGGAAAGCCTGG - Intergenic
911471658 1:98326837-98326859 TTGGAAACACTGGGAACCACTGG + Intergenic
915825516 1:159071884-159071906 TGGGACTAGCTTGGAAACTCAGG - Intronic
917289169 1:173454520-173454542 TTGGAATAAGGGGCAAACTTGGG + Intergenic
918987773 1:191655466-191655488 ATGGAATAACTGTGAAGCTAAGG - Intergenic
920694635 1:208172819-208172841 AAGGAGTAACTGGGATACTCTGG + Intronic
920737670 1:208548489-208548511 TTGGCAAAAATGGAAAACTCCGG + Intergenic
1062887509 10:1029202-1029224 TTGGTATTACTGGGAAAATTTGG + Intergenic
1065633310 10:27704622-27704644 TTAGAATAACTGGGTAACTGTGG + Intronic
1065871182 10:29957758-29957780 TTTGAATGCCTGGGAACCTCTGG + Intergenic
1070204274 10:74240929-74240951 TTTCACTATCTGGGAAACTCCGG + Intronic
1071228729 10:83561910-83561932 TTGGAATACCTGGGGATCCCTGG - Intergenic
1072533306 10:96339731-96339753 ATGTCATAACTGGGAAACACTGG - Intergenic
1073775584 10:106782148-106782170 GTGAAATGACTGGGAAACTATGG + Intronic
1078252360 11:9626779-9626801 TTGGAATAACTGCGAGAAACTGG + Intergenic
1078429863 11:11280575-11280597 TGGGAAAAACTGGGAGACGCAGG - Intronic
1078962066 11:16287860-16287882 TTGGAGTCAATGGGAAACTTAGG - Intronic
1080043098 11:27779887-27779909 CTGGAACAACTGGAAACCTCTGG + Intergenic
1080861140 11:36151130-36151152 TTTGAACAACTGGAAACCTCTGG - Intronic
1081626707 11:44660189-44660211 TTGGAACAACGGGGAAACTGAGG - Intergenic
1082879340 11:58022939-58022961 TGGGAACAAATGGGAAACTGAGG - Intergenic
1084444127 11:69193572-69193594 TTGGTATAAATGGGAAACGGAGG + Intergenic
1086370505 11:86151410-86151432 TTTGAGTATCTGGGAGACTCAGG - Intergenic
1087412006 11:97803331-97803353 TTGCAATTACTGGGAAAATATGG + Intergenic
1087644603 11:100793443-100793465 ATGGATTACCTGGGAGACTCAGG - Intronic
1089147127 11:116337237-116337259 ATGGAATAATTTGGAAACTCTGG + Intergenic
1090681156 11:129058641-129058663 TTGGTTTAAGTGGGAAACGCTGG - Intronic
1091988477 12:4934116-4934138 TGGGAATAAAAGGGAAACTGAGG - Intergenic
1092624007 12:10305745-10305767 TTGGAATATTTGGGGAACTATGG - Intergenic
1092841328 12:12544537-12544559 TTGGAATAACTGTGGAAAACTGG - Intronic
1096030716 12:48411698-48411720 TTGGATTAGCTTGGAAACTTTGG + Intergenic
1096357504 12:50953672-50953694 TTGAGATCACTGGGAACCTCAGG - Intergenic
1097514122 12:60582196-60582218 AAGGAATTCCTGGGAAACTCTGG + Intergenic
1098512635 12:71335899-71335921 TTGGACTAACTGGGAAAAACAGG - Intronic
1100432639 12:94544187-94544209 TTTGAAAAATTGGAAAACTCTGG - Intergenic
1104044651 12:125153335-125153357 TTGGAATAAAAGGGAAGATCAGG + Intergenic
1107389743 13:39951553-39951575 TGGGAAGAACAGGGAAACTTTGG + Intergenic
1107724158 13:43280938-43280960 TTTAAATAACTTGGAAACTTTGG - Intronic
1110345090 13:74437817-74437839 TTGAAGTAACTTGGACACTCAGG + Intergenic
1110593386 13:77291158-77291180 TTAGAATATATGAGAAACTCTGG + Intronic
1112380652 13:98886051-98886073 TAGGAAGAACTGGAAAACACAGG + Intronic
1114943798 14:27651928-27651950 TTGGATTCACTGGGAAGCTTTGG + Intergenic
1117521402 14:56554836-56554858 TTGCACAGACTGGGAAACTCTGG + Intronic
1127217247 15:56836274-56836296 TTTGAGTAACTGGGAAGTTCGGG - Intronic
1127646098 15:60960911-60960933 ATGTCATAACTGGGAAACTGAGG + Intronic
1127713912 15:61628679-61628701 TTGTAATAAATAGGAAACTCAGG + Intergenic
1130024243 15:80257551-80257573 TGGGGATAACTGGGATACACTGG + Intergenic
1132416326 15:101622015-101622037 TTGGAATAACTGGGAAACTCAGG + Intronic
1133066958 16:3214856-3214878 TTGGAATGTCTTGGAAACACAGG - Intergenic
1137966594 16:52940306-52940328 TTGGTCTAATTGGGATACTCTGG + Intergenic
1139824120 16:69743791-69743813 GTGGAACAACTGGCAAAATCTGG + Intronic
1140896699 16:79331098-79331120 TAGGAATAAATGGGAAACTGAGG - Intergenic
1143499764 17:7331860-7331882 TTTGAATGACTGGGAAAATGAGG + Intergenic
1148973835 17:51509561-51509583 TTGGAATAAATGGAAAACAGGGG - Intergenic
1150045721 17:61911556-61911578 TTGGAACAAATGCGAAAGTCCGG - Exonic
1151799760 17:76371408-76371430 TTAGAATCACTGGGGAACTCTGG + Intronic
1153384785 18:4479725-4479747 TTGAAATAAATAGGAAACTGGGG + Intergenic
1156665749 18:39404401-39404423 TTGGAAGATCTGCGAAGCTCAGG + Intergenic
1156753627 18:40493270-40493292 ATGGTATAACTGGGAAGCACAGG - Intergenic
1157873861 18:51253936-51253958 TTGGGCTGACTGGGACACTCTGG - Intergenic
1160081335 18:75730347-75730369 GTTGAATAACCGGGAGACTCAGG - Intergenic
1162673538 19:12279437-12279459 ATGTTATAACTGGGTAACTCTGG - Intronic
1165864910 19:38931041-38931063 CAGGAAGAACTGGGAAACTGGGG - Exonic
926285936 2:11488183-11488205 TTAGACCAACTCGGAAACTCGGG + Intergenic
930097653 2:47578587-47578609 TTAGAATAATTGGAAAATTCAGG + Intergenic
930280104 2:49359750-49359772 TTTGAATAACATGGAAACTGAGG + Intergenic
931826411 2:66004943-66004965 TTTGATTAACTGGGAGACACCGG - Intergenic
931879435 2:66552553-66552575 ATGAAATAACTAGGAAAATCTGG - Intronic
932096401 2:68853461-68853483 TTGGAATATCTGGTACACACAGG + Intergenic
933133219 2:78699208-78699230 TTGGAATAACTAGAAAATTAAGG - Intergenic
933865327 2:86510763-86510785 TTGGAGTAACTGTGACACCCAGG + Intronic
934776482 2:96940987-96941009 TGGGGAGAACTGGGAAACTCTGG + Intronic
936493605 2:112997616-112997638 TTGGACTATATGGAAAACTCAGG + Intergenic
936918152 2:117661128-117661150 TTGGAATCACTGGGAAATAGTGG + Intergenic
938398456 2:130967783-130967805 CTGGAATAACTCAGAACCTCTGG - Intronic
939138296 2:138323038-138323060 TTGGAAGAATGGGGAAACTGAGG - Intergenic
940249183 2:151655403-151655425 TTTGAATAACTGGGACAAGCAGG + Intronic
941838689 2:170054845-170054867 TTGGAATAGCTGTGGAACCCTGG - Intronic
945799073 2:214402769-214402791 TGGGAATAAGTGACAAACTCAGG - Intronic
946074317 2:217061489-217061511 CTGAAAGAACTGGGAAACTGAGG - Intergenic
947591982 2:231391039-231391061 TGAGAATCACTGGGAATCTCTGG + Intergenic
948678691 2:239615497-239615519 CTGGAATACCTGTGCAACTCAGG - Intergenic
1170419157 20:16175412-16175434 TTGGTATAACTGGGAAATTGTGG + Intergenic
1170694067 20:18642270-18642292 TTGGGATAACTGGTAAATTATGG - Intronic
1171152171 20:22836897-22836919 TTTGAAGAACTATGAAACTCCGG - Intergenic
1174208875 20:48861288-48861310 TTGGAAAGATTGGGAAACTGAGG - Intergenic
1174537185 20:51260265-51260287 TTGGCATAACTGAGAAACCCAGG - Intergenic
1174893090 20:54419112-54419134 ATGGAAGAACTGGGAAACTTTGG + Intergenic
1178418683 21:32425743-32425765 TGGGAATATCTGGCAATCTCTGG + Intronic
952868056 3:37870913-37870935 TTGTAATAAATGGGCCACTCTGG - Intronic
954151314 3:48658676-48658698 TTGGAATCACTGGGATTCTGTGG + Intronic
955579031 3:60398835-60398857 TGGGAAAAACTGACAAACTCTGG + Intronic
955682266 3:61514600-61514622 TTGGAATAACTTGGTGACACAGG - Intergenic
955942626 3:64160569-64160591 TTGGAAAAACAGGGAAACAAAGG + Intronic
956547797 3:70425143-70425165 TTGGAGAAACTGGGAAACAGTGG - Intergenic
961661177 3:128469568-128469590 TTCGAGTAACTGAGGAACTCAGG - Intergenic
962042912 3:131725796-131725818 TTGGAATATCTGGCAACCTTGGG + Intronic
962404814 3:135091879-135091901 CTGGAAAAAGTGAGAAACTCTGG + Intronic
971543186 4:27848431-27848453 TTGAAATACCTGGTAAAGTCAGG + Intergenic
971815719 4:31485507-31485529 TTGGACAAACTGGGACACTTTGG - Intergenic
978312426 4:107399226-107399248 TTGGAATAACTTACAAACTTAGG + Intergenic
979207372 4:118054987-118055009 TGGGATTTACTGGGAAAGTCTGG + Intronic
983029254 4:162778965-162778987 TTGGACTAACTTGGAAACTTGGG + Intergenic
985516382 5:347250-347272 TTGTAAGAACTTGGAAACTAGGG + Intronic
986748462 5:10763849-10763871 TTGTACTGATTGGGAAACTCTGG + Intergenic
989268516 5:39504923-39504945 TGGGAATAACTGGGAAATGCAGG - Intergenic
990624216 5:57593437-57593459 CAGGAATGACAGGGAAACTCAGG + Intergenic
991455994 5:66805195-66805217 CTGGAATAACTGGCTATCTCTGG - Intronic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
994190956 5:96868700-96868722 ATGGAATTAATTGGAAACTCGGG - Intronic
994611912 5:102052801-102052823 TTGGAATAAGAGTGAAACTTGGG + Intergenic
994825082 5:104703044-104703066 TTGGGATAATTTGGACACTCAGG + Intergenic
997090540 5:130851284-130851306 TTGTAATAACAGGAAAACTGTGG + Intergenic
999649797 5:153754333-153754355 TTGGAATAACTGGAGAGCTAGGG - Intronic
1002045731 5:176540879-176540901 TTTGAAAAACTGGAAAATTCTGG - Intergenic
1005508449 6:26490896-26490918 CTGGAATAAGTGGCTAACTCTGG - Intergenic
1006603429 6:35240650-35240672 TTTGAAGAACTGGGAGACTGCGG + Intronic
1008062042 6:47008883-47008905 TTGGAATAAGTAGAGAACTCAGG - Intronic
1008984061 6:57520793-57520815 TTGGAATAAATAGGAAAATATGG + Intronic
1009172119 6:60413701-60413723 TTGGAATAAATAGGAAAATATGG + Intergenic
1011389390 6:86835555-86835577 TTGGAATAAATAGGAAGCTGTGG - Intergenic
1011948401 6:92935302-92935324 TAGGAATATCTGGGAAAGGCTGG - Intergenic
1012080584 6:94752837-94752859 TAAGAATAACTGGGAATGTCAGG - Intergenic
1014510087 6:122309961-122309983 TTGGAATAACTTAGAGCCTCAGG + Intergenic
1015492792 6:133846747-133846769 TTGGAACAATTTGGAAATTCAGG - Intergenic
1018377805 6:163230295-163230317 TTGGAATAACTGGTATTCTAAGG - Intronic
1018566953 6:165164221-165164243 TTGGAAAACGTGGGAAAGTCTGG - Intergenic
1019585677 7:1801618-1801640 CTGGAAAAACTTGGAAAGTCTGG + Intergenic
1020348447 7:7190795-7190817 TGGGTGTAACTGGGAAATTCTGG - Intronic
1020600101 7:10263907-10263929 TTCGTATAACTATGAAACTCAGG + Intergenic
1021272927 7:18614322-18614344 TTGGCAGAACTGAGAAACTCAGG - Intronic
1028091567 7:86709207-86709229 TTGGAATAACTGAAAAATTTAGG - Intronic
1028127230 7:87127136-87127158 GAGGAATAAATGTGAAACTCGGG + Intergenic
1029907468 7:104105811-104105833 TTGGGGTAAATGGAAAACTCAGG - Intergenic
1030321119 7:108168928-108168950 TGAGTATCACTGGGAAACTCAGG + Intronic
1030415772 7:109240888-109240910 TTTGAATAACTGGTTAAATCTGG - Intergenic
1032378809 7:131453545-131453567 TATGAATAAATGGGAAAATCTGG + Intronic
1035155180 7:156906358-156906380 TGGGAGTAACCAGGAAACTCTGG - Intergenic
1037020810 8:13967890-13967912 TTGGATCCACTGGGAGACTCTGG - Intergenic
1037998445 8:23370002-23370024 TTGCAGTAACTGTGCAACTCTGG - Intronic
1040580563 8:48695499-48695521 ATGGAAGATCTGGGAAGCTCAGG - Intergenic
1040716842 8:50265355-50265377 TTGGAATAACTGGAAACCACCGG + Intronic
1041040449 8:53841307-53841329 TTGGAATAAGTGGGAAACATAGG - Intronic
1044180348 8:89186001-89186023 TTGGGATAACTGGGATATTTGGG - Intergenic
1044394558 8:91695216-91695238 CTGGAATCTCTGTGAAACTCTGG + Intergenic
1044576082 8:93770411-93770433 TTTGAACAACTGGGAAAATTTGG - Intronic
1045385158 8:101665402-101665424 TTGGATTATCTGGGAAGCTCAGG + Intronic
1045745516 8:105415149-105415171 TGAGAATAACTGGGAAATTCTGG - Intronic
1046338782 8:112825368-112825390 TTGGAAGACCAGGGACACTCTGG + Intronic
1049421967 8:142521004-142521026 GTGGGATCCCTGGGAAACTCAGG + Intronic
1050530519 9:6584786-6584808 ATGGTATAGCTGGGAATCTCAGG + Intronic
1053064483 9:35058038-35058060 TTGCAATCATTGGGAAACCCTGG - Intronic
1054971395 9:71091637-71091659 TTGGAGTAACTGGAAACCCCAGG - Intronic
1055551857 9:77438965-77438987 CTGGAACAACTGGCAAACTTTGG - Intronic
1055720705 9:79170745-79170767 TGAGAATAAGAGGGAAACTCAGG + Intergenic
1056443274 9:86641178-86641200 TGGGAACATCTGGGAAACACTGG + Intergenic
1057886219 9:98831833-98831855 TTCGAATACCTGGGGAACTCCGG + Exonic
1058830592 9:108812801-108812823 TCTGAATAAAAGGGAAACTCTGG - Intergenic
1058884914 9:109315649-109315671 TTGGAGAAACTGGGAAGCTGTGG - Intronic
1059947271 9:119422885-119422907 TTGGAATAACTTGGGAAACCAGG - Intergenic
1060512116 9:124241752-124241774 ATGGAATAAATGAAAAACTCTGG + Intergenic
1186495476 X:10009659-10009681 TTGGCACAACTGGGAGACTGGGG - Intergenic
1187603093 X:20854270-20854292 TTGGAATAACTGATAAAATTTGG - Intergenic
1188309281 X:28597340-28597362 TTGGAATAAGCGTGAAACTCAGG - Intronic
1189484968 X:41423403-41423425 ATGGAAAAACTGGGGAAATCTGG - Intergenic
1198892388 X:141412412-141412434 TTTGAAGAACTGGGAAATTGTGG + Intergenic
1199474619 X:148231632-148231654 TTGAAACAACTGAGAAACCCGGG - Intergenic
1201750575 Y:17427389-17427411 TTGGAATAACTTGGAAGGTTTGG + Intergenic
1202021510 Y:20469320-20469342 TTGGATTAACTGAGAATTTCTGG - Intergenic