ID: 1132416581

View in Genome Browser
Species Human (GRCh38)
Location 15:101624577-101624599
Sequence AAGCCATCCTGGCCCTCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1188
Summary {0: 1, 1: 9, 2: 108, 3: 262, 4: 808}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132416576_1132416581 24 Left 1132416576 15:101624530-101624552 CCATAATGTTTTAGGAAAGTTTA 0: 2
1: 19
2: 36
3: 77
4: 331
Right 1132416581 15:101624577-101624599 AAGCCATCCTGGCCCTCATGTGG 0: 1
1: 9
2: 108
3: 262
4: 808
1132416575_1132416581 25 Left 1132416575 15:101624529-101624551 CCCATAATGTTTTAGGAAAGTTT 0: 2
1: 11
2: 18
3: 59
4: 374
Right 1132416581 15:101624577-101624599 AAGCCATCCTGGCCCTCATGTGG 0: 1
1: 9
2: 108
3: 262
4: 808

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132416581 Original CRISPR AAGCCATCCTGGCCCTCATG TGG Intronic
901152695 1:7114527-7114549 AAGCCGTCCTGGGCTGCATGTGG + Intronic
901257296 1:7841198-7841220 AAGCCATCCTGGGCCGCATGTGG + Intronic
901958539 1:12806754-12806776 AAGTCCTCCTGGCCATAATGGGG + Intergenic
902035333 1:13453867-13453889 AAGCCATCCTGAGCCCCATGTGG - Intergenic
902163092 1:14548123-14548145 AAGCCACCCTGGGCTGCATGTGG + Intergenic
902912423 1:19609941-19609963 AGACCATCCTGGCCAACATGGGG + Intronic
902927445 1:19705597-19705619 AAGCCATCCTGGGTGGCATGTGG + Intronic
903042189 1:20539636-20539658 TAGCCATCCTGGGCCACATGTGG + Intergenic
903140710 1:21337576-21337598 ATGCCAGACTGGACCTCATGAGG - Intronic
903225937 1:21894309-21894331 GAGCCATCCTGCCTGTCATGGGG - Intronic
903258855 1:22120497-22120519 AGGCCATCCTGACACACATGCGG - Exonic
903503137 1:23813086-23813108 AAACCAGCCTGGCCAACATGGGG - Intronic
903715106 1:25359583-25359605 AAGCTGTCCTGGGCCACATGTGG + Intronic
903738010 1:25542688-25542710 AAGCCGTCCTGGACCTCACATGG - Intergenic
904057811 1:27683824-27683846 AAACCAGCCTGGCCAACATGGGG - Intergenic
904084831 1:27898755-27898777 AGACCATCCTGGCCAACATGGGG - Intronic
904405034 1:30282772-30282794 AAGCCATCCTGGGCCTCATGTGG - Intergenic
905567172 1:38974801-38974823 AGACCATCCTGGCCAACATGAGG - Intergenic
905698261 1:39992104-39992126 AAGCCATCCTGGGCTGCATGTGG + Intergenic
905708567 1:40081335-40081357 AAACCAACCTGGCCAACATGAGG + Intronic
905746946 1:40426232-40426254 AAGCCATCCTGGGCCGAATGCGG + Intergenic
906390971 1:45415866-45415888 AAGCCATTCTGGGCTACATGTGG - Intronic
906843847 1:49168788-49168810 ACTCCATCCTGGCCCACCTGTGG - Intronic
907140938 1:52184442-52184464 AGGCCAGCCTGGCCAACATGAGG - Intronic
907187337 1:52619809-52619831 AAGCCATCCTGGGCCGCACGTGG - Intergenic
907193844 1:52670363-52670385 AAACCAGCCTGGCCAACATGGGG + Intergenic
907221406 1:52909605-52909627 AAGCCATCCTGGGCCACATGCGG + Intronic
907755759 1:57308976-57308998 AAGCCACCCTGGGCTACATGTGG - Intronic
908006185 1:59731712-59731734 AATCCCTCCTGGCCCTCACAAGG - Intronic
908018937 1:59879695-59879717 AAGCCATCCTGGGCCGCTTGTGG + Intergenic
908237561 1:62161535-62161557 AGACCAGCCTGGCCCACATGGGG - Exonic
908282172 1:62551427-62551449 AAGCTGTCCTGGGCCACATGTGG + Intronic
908588577 1:65603611-65603633 AAGCTATCCTAGTCCACATGGGG - Intronic
908828762 1:68158664-68158686 AAGCCGTCCTGGGCTGCATGCGG + Intronic
909582727 1:77256179-77256201 AAACCATCCTGGGCCACATGTGG - Intergenic
909953421 1:81748276-81748298 AGACCATCCTGGCCAACATGGGG + Intronic
910001120 1:82343444-82343466 AACACATCCTGGCTCCCATGTGG + Intergenic
910109266 1:83665011-83665033 AGGCCATCCTGGGCCACATGTGG - Intergenic
910203609 1:84725225-84725247 AAGCCATCCTGGGCCTCCTGTGG - Intergenic
910272221 1:85409053-85409075 AAGCCATCCTGGGCTGCATGTGG - Intronic
910275826 1:85448061-85448083 AAGCCGTCCTAGGCCACATGTGG - Intronic
910660071 1:89662225-89662247 AAGCCATCCTGGGCCACAAGTGG + Intronic
910863382 1:91764969-91764991 AAGCCATCCTGGGCAGCATGTGG - Intronic
911579486 1:99618625-99618647 AGACCATCCTGGCCAACATGGGG - Intergenic
911586272 1:99694994-99695016 AAGCCATCCTGGGCCACATGCGG + Intergenic
911809135 1:102251718-102251740 AAGCCATCCTGGGCCACAGGTGG + Intergenic
911868213 1:103055663-103055685 AAAGCCTCCTGGGCCTCATGTGG - Intronic
911880516 1:103232685-103232707 AAACCAGCCTGGCCAGCATGGGG + Intergenic
912399664 1:109379378-109379400 AAGCCACCCTGGGCCACATGTGG + Intronic
912530805 1:110320099-110320121 AAACCAGCCTGGCCAACATGGGG + Intergenic
912531386 1:110325834-110325856 AGACCATCCTGGCCAACATGGGG - Intergenic
912546201 1:110453456-110453478 CCCCCATCCTGGCCCTCAAGTGG - Intronic
912933962 1:113986767-113986789 AAGCCATCCTGGGCCACATGTGG + Intergenic
912939933 1:114035858-114035880 AAGCCATCCTGGGCTGCATATGG + Intergenic
912995367 1:114527723-114527745 AAACCAGCCTGGCCAACATGGGG + Intergenic
913140286 1:115934459-115934481 AAGCCATCCTAGGCCACATGTGG + Intergenic
913358957 1:117957614-117957636 AAGCCATACTGGGCCACATGTGG - Intronic
913394267 1:118349108-118349130 AAGCCATACTGGACCACATGTGG - Intergenic
913420174 1:118658296-118658318 AAGCCATCCTGGGCCACATGTGG + Intergenic
913482436 1:119301638-119301660 AAGCCAGCCTGGCCATGTTGGGG - Intergenic
914835731 1:151205372-151205394 AGGCCAGCCTGGCCAACATGGGG - Intronic
914886754 1:151591478-151591500 AAGCCATCCTGGGCCGCGTCAGG + Intergenic
914976482 1:152368427-152368449 AAGCCATCCTAGGCTGCATGTGG + Intergenic
915026826 1:152838650-152838672 AAGCCGTCCTGGGTCACATGGGG + Intergenic
916669208 1:166997276-166997298 AAGCCATCCTGGGCCGCATGAGG + Intronic
916771106 1:167909474-167909496 AAGCCATCCTGGACCGCATGTGG - Intronic
917265275 1:173214655-173214677 AAGCCGTCCTGGGCCACATGTGG + Intergenic
917295167 1:173511228-173511250 AGACCATCCTGGCCAACATGGGG - Intronic
917543047 1:175934084-175934106 AAGCCGTCCTGGGCTGCATGTGG - Intergenic
917804363 1:178599863-178599885 TAGCCATCCTGTCCCACATAAGG + Intergenic
918310224 1:183280331-183280353 AAGCCACCCTGGGCCACATGTGG - Intronic
918334667 1:183496896-183496918 AAGCCGTCCTGGGCTGCATGTGG + Intronic
918381545 1:183960683-183960705 GAGCAATCCTGGGCCACATGTGG - Intronic
918512443 1:185326044-185326066 AGACCATCCTGGCCAACATGGGG - Intergenic
918952991 1:191164492-191164514 AAGCCAGCCTGACCAACATGGGG - Intergenic
919499744 1:198322894-198322916 AAGCCATTCTGGGCCGCATGCGG + Intergenic
919515169 1:198513356-198513378 AAACCAGCCTGGCCAACATGGGG - Intergenic
919633865 1:199985305-199985327 AAGCCATCCTGGGCCGCATGTGG + Intergenic
919880884 1:201899786-201899808 AAGGCATCCTGGCCATCTTCCGG - Exonic
920202919 1:204271062-204271084 AAGCCATCCTGGGCTGCGTGTGG - Intronic
920268614 1:204745807-204745829 AAGCCATCCGGGGTCACATGCGG + Intergenic
920290337 1:204918287-204918309 AAGCCATCCTGGACTGCATGTGG - Intronic
920302898 1:205000246-205000268 AAGCCTTCCTCTCCCTCACGTGG - Intronic
920326012 1:205164659-205164681 AGACCATCCTGGCCAACATGGGG - Intronic
920332783 1:205222913-205222935 AAGCCGTCCTGGGCTGCATGCGG + Intergenic
920577686 1:207073766-207073788 AAGCCATCATGGTCATCAAGGGG - Exonic
920608488 1:207413673-207413695 AAGCCATCCTGGGCCACATGTGG + Intergenic
920755058 1:208721523-208721545 AAACCATCCTGGCCCAGATCTGG + Intergenic
921118400 1:212115845-212115867 AAGCCATCCTGGGCCGCATGTGG + Intergenic
921372154 1:214435037-214435059 AAGCCATCCTAGGCTGCATGTGG + Intronic
921409291 1:214817713-214817735 AAGCTATCCTGGGCTGCATGTGG - Intergenic
921784877 1:219218430-219218452 AAGCTGTCATGGCCCACATGTGG - Intergenic
922005705 1:221528611-221528633 AAGACATCCTGGCTTTCATTTGG - Intergenic
922237089 1:223730268-223730290 AAGCCATCCTGGGCAGCACGAGG - Intronic
922435995 1:225607304-225607326 AAGCCATCCTGGGCCACATGTGG + Intronic
922641336 1:227234833-227234855 AAGCCGTTCTGGGCCACATGCGG - Intronic
922755661 1:228095454-228095476 AAGCCATCCTGGGCCACATGCGG - Intronic
923004983 1:230041436-230041458 AAACCAGCCTGGCCAACATGGGG - Intergenic
923116763 1:230947624-230947646 AAGCCATCCTGGGCTGCATGTGG + Intronic
923472940 1:234308377-234308399 AAGCCAGCCTGGACCACATGTGG - Intronic
923576815 1:235165865-235165887 AGACCATCCTGGCCAACATGGGG - Intronic
923660785 1:235955269-235955291 AAGTCATCCTGGGTCACATGTGG - Intergenic
923726006 1:236506026-236506048 AGGCCAGCCTGGCCAACATGGGG - Intergenic
923954660 1:239002233-239002255 AAACCATCCTGGGACACATGTGG - Intergenic
924415727 1:243854513-243854535 AGACCATCCTGGCCAACATGGGG - Intergenic
924598158 1:245465176-245465198 AGACCATCCTGGCCAACATGGGG - Intronic
924811107 1:247403039-247403061 AAACCAGCCTGGCCACCATGGGG + Intergenic
924942202 1:248819790-248819812 AAGCCATCCTGGGCTGCATGCGG + Intronic
1062767292 10:75454-75476 AGACCAGCCTGGCCCACATGAGG + Intergenic
1062977594 10:1696892-1696914 AAGCCATCATGGGCTGCATGTGG - Intronic
1063599024 10:7463368-7463390 AAGCCATCCTGGGCTGCATGCGG + Intergenic
1063641481 10:7835290-7835312 AAGCCGTCCTGGGCCGCATATGG + Intronic
1064132905 10:12725953-12725975 AAACCAGCCTGGCCAACATGAGG - Intronic
1064189137 10:13190045-13190067 AAGCCATCCTGGGCTGCATGTGG + Intronic
1064368971 10:14734405-14734427 AAGCCGCCCTGGACCACATGTGG - Intronic
1064644018 10:17442065-17442087 AAACCAGCCTGGCCAACATGAGG - Intronic
1065248378 10:23783261-23783283 AAGCTATCCTGGCCTGCATGTGG + Intronic
1065275516 10:24081778-24081800 AAGCTGTCCTGGGCCACATGTGG + Intronic
1065436097 10:25705326-25705348 AGACCATCCTGGCCAACATGGGG - Intergenic
1065527485 10:26637916-26637938 AAGTCATCGTGGTCCCCATGGGG - Intergenic
1065559355 10:26946472-26946494 AAGTCATCGTGGTCCCCATGGGG + Intergenic
1065685205 10:28277473-28277495 AAGCCGTCCTGGGCTGCATGCGG + Intronic
1065744573 10:28827917-28827939 AAACCAGCCTGGCCAACATGGGG - Intergenic
1065763995 10:29009453-29009475 AGACCATCCTGGCCAACATGGGG - Intergenic
1066250628 10:33629553-33629575 AAGCCATCCTGGGACACATGTGG + Intergenic
1066296508 10:34058566-34058588 AAGCCATCCCGGGCTGCATGTGG - Intergenic
1066302284 10:34107724-34107746 AAGCCATCCCAGGCCACATGTGG + Intergenic
1066326890 10:34369216-34369238 AAGCCATCCTGGACCACATGCGG - Intronic
1067094943 10:43294246-43294268 AGCCGATCCTGCCCCTCATGTGG + Intergenic
1067408799 10:46046935-46046957 AGGCCATCCTAGCCATGATGAGG - Intergenic
1068016334 10:51521086-51521108 AAACCAGCCTGGCCAACATGGGG + Intronic
1068036779 10:51769934-51769956 AAGTCATCCTGGGCCGCATGTGG + Intronic
1068046299 10:51890755-51890777 AAACCAGCCTGGCCAACATGGGG + Intronic
1068140687 10:53003060-53003082 AAGCAATCCTGAGCCACATGTGG + Intergenic
1068392557 10:56417083-56417105 AAGCCATCCTGGGCCACATGTGG + Intergenic
1068430690 10:56928413-56928435 AAGGCATCCTGGCCCTGGGGAGG - Intergenic
1068458084 10:57286150-57286172 AAGCCATCCTGGGCTGCATGTGG + Intergenic
1068968835 10:62941180-62941202 AAGCCATCCTGGGCCACATGTGG - Intergenic
1068988333 10:63127229-63127251 AAGCCGTCCTGGGTCGCATGCGG - Intergenic
1069204161 10:65660976-65660998 AAGCTATCCTGGGCTGCATGTGG - Intergenic
1069728716 10:70597921-70597943 AAGCCATCCTGGGCCGCATGCGG + Exonic
1070231066 10:74568065-74568087 AAGCCATCCAGGGCTGCATGTGG - Intronic
1070247006 10:74742402-74742424 AAACCAGCCTGGCCAACATGGGG - Intergenic
1071113402 10:82189455-82189477 AAACCAGCCTGGCCAACATGAGG + Intronic
1071174132 10:82904129-82904151 AAGCTGTCCTGGGCCACATGTGG - Intronic
1071369133 10:84933476-84933498 AGACCAGCCTGGCCCACATGGGG - Intergenic
1071793038 10:88976274-88976296 AAGCCATCCTGGGCTGCATGTGG + Intronic
1072095654 10:92176878-92176900 AAGCCGTCTTGGGCCACATGTGG - Intronic
1072112113 10:92332717-92332739 AGACCATCCTGGCCAACATGGGG - Intronic
1072156462 10:92728483-92728505 AAGCCATCCTGGGCCACGTGTGG + Intergenic
1072216981 10:93295530-93295552 AAGCCGTCCTGGGCTGCATGTGG - Intergenic
1072262919 10:93698837-93698859 AAGCCATCCTGGGCCACATGAGG - Intronic
1072468764 10:95692684-95692706 AAGCCGTCCTGGGCTGCATGCGG - Intronic
1073045295 10:100634224-100634246 TGGCCATCCTGGCCCTCAGGTGG - Intergenic
1073052398 10:100676255-100676277 AAGCCATCTTGGGCTGCATGCGG - Intergenic
1073241411 10:102061108-102061130 AGGCCAGCCTGGCCAACATGGGG + Intergenic
1073399095 10:103242116-103242138 AATACCTCCTGGCCCTCGTGAGG - Intergenic
1073407873 10:103313678-103313700 CAGCTATCCTGGGCCACATGTGG + Intronic
1073530548 10:104228040-104228062 AGACCATCCTGGCCAACATGGGG - Intronic
1073580624 10:104662607-104662629 AACCCATCTTAGCCCTCATGGGG - Intronic
1073727314 10:106248118-106248140 AAGCCGTCCTGGGCTGCATGTGG - Intergenic
1073914402 10:108385648-108385670 AGACCATCCTGGCCAACATGGGG + Intergenic
1074171918 10:110948849-110948871 AAGCCATCCTGGGCTGCATGTGG - Intronic
1074568841 10:114606432-114606454 AGACCATCCTGGCCAACATGGGG - Intronic
1074990014 10:118696684-118696706 AAGCCATACTAGGCCGCATGCGG + Intronic
1075030919 10:119024258-119024280 AAGCTGTCCTGGGCCACATGAGG + Intergenic
1075155845 10:119975278-119975300 CAGCCTTCCTGGCTCTCCTGTGG + Intergenic
1075408899 10:122212792-122212814 AGGCCATCCTGGCCAAAATGGGG + Intronic
1075435646 10:122438943-122438965 AAGCCGTCCTGGGCCACATGCGG + Exonic
1075524137 10:123168475-123168497 AAGCCATCCTGGGCAGCATGTGG - Exonic
1076063931 10:127433747-127433769 AAGCCATCCTGGGCTGCATGTGG - Intronic
1076075823 10:127533126-127533148 AAGCCATCCTGGGCCACATGTGG - Intergenic
1076366280 10:129922735-129922757 CAGCCCTCCTGACCCTGATGTGG + Intronic
1077673462 11:4178328-4178350 AAGCCATCCTGGGCTGCATGTGG + Intergenic
1077943038 11:6863889-6863911 AAGCCATCTTGGGCCGCATGTGG - Intergenic
1078540532 11:12209725-12209747 AGACCATCCTGTCCCTCTTGAGG + Intronic
1078859180 11:15231472-15231494 AAGCTGTCCTGGGCCACATGTGG + Intronic
1079192772 11:18294899-18294921 AAGCCGTCCTGGAACACATGAGG + Intronic
1079371109 11:19853427-19853449 AAGCCATCCTGGGCTGCAGGTGG - Intronic
1079941956 11:26692190-26692212 AAGCCATCCTGGGCCGTATGCGG + Intronic
1080011211 11:27461549-27461571 AAGCCATCCTAGGCTGCATGGGG - Intronic
1080514375 11:33006504-33006526 AGACCATCCTGGGCCACATGGGG - Intergenic
1080637266 11:34134930-34134952 CAGCCATCCTTACCCTCAAGTGG + Intronic
1080813081 11:35725532-35725554 AAACCAGCCTGGCCAACATGAGG - Intronic
1081066769 11:38551509-38551531 AAACCAGCCTGGCCAACATGGGG - Intergenic
1081296470 11:41395966-41395988 AAGCCGTCCTGGGCCACATGTGG - Intronic
1081308365 11:41541021-41541043 AAACCAGCCTGGCCAACATGGGG + Intergenic
1081504597 11:43702730-43702752 AAGCCATCCTGGGCCACATGTGG - Intronic
1081874425 11:46398970-46398992 AAACCAGCCTGGCCAACATGGGG - Intronic
1082069183 11:47924850-47924872 AGACCATCCTGGCCAACATGGGG + Intergenic
1082243397 11:49893013-49893035 AAGGCTTCCTGGCCATCATCAGG + Intergenic
1082757949 11:57096671-57096693 AGACCATCCTGGCCAACATGTGG - Intergenic
1083409517 11:62482214-62482236 AGACCATCCTGGCCAACATGGGG + Intronic
1083813636 11:65119431-65119453 AGACCATCCTGGCCAACATGGGG + Intergenic
1083971163 11:66076589-66076611 AAACCAGCCTGGCCAACATGGGG - Intronic
1084139780 11:67218468-67218490 AAGCCATCCTGGGCTGCATGAGG - Intronic
1084514060 11:69626269-69626291 AAGCCATCCTGGGCCGCATGAGG - Intergenic
1085138019 11:74111706-74111728 AAGCCATCCTGGGCCACTTGTGG - Intronic
1085178777 11:74514300-74514322 AAGCCATTCTGGGCCACATGTGG + Intronic
1085470654 11:76755520-76755542 AAGCCGTCCTGGGCCACATGCGG + Intergenic
1085494821 11:76959455-76959477 AAGCCATCCTGGGTCACATGCGG - Intronic
1085494912 11:76960208-76960230 AGACCATCCTGGCCAACATGTGG + Intronic
1086310617 11:85532374-85532396 AAGCCTTCCTGCTCCTCATATGG - Intronic
1087700822 11:101434490-101434512 AAGGCATCCTGGGCCACATGTGG - Intergenic
1087820348 11:102704576-102704598 TAGCCATACTGGCCCACATCAGG + Exonic
1087838731 11:102900858-102900880 CAGAAGTCCTGGCCCTCATGAGG + Intergenic
1087875712 11:103353976-103353998 AGACCATCCTGGCCAACATGAGG + Intronic
1087991452 11:104748795-104748817 AAGCAGTCCTGGGCCACATGTGG - Intergenic
1088298549 11:108328836-108328858 AAGCCGTCCTGGGCCACATGCGG + Intronic
1088313013 11:108480032-108480054 AGGCCAGCCTGGCCAACATGGGG - Intronic
1088373534 11:109116811-109116833 GAGCCATCCTGGGCCACATGCGG + Intergenic
1088446219 11:109931599-109931621 AAGCCATCCTGGTCTGCAGGCGG - Intergenic
1088888019 11:114022859-114022881 AAGCTGTCCTGGGCCACATGCGG + Intergenic
1088942343 11:114472461-114472483 AAGCCATCCTGGGTCACATGTGG + Intergenic
1089568191 11:119383751-119383773 AAGCCATCCTGGGCCACATGTGG + Intergenic
1089845626 11:121455792-121455814 AAACCAGCCTGGTCCACATGGGG + Intronic
1089891288 11:121883996-121884018 AAGCCATCCTGGGCTGCATGTGG - Intergenic
1090215415 11:124958284-124958306 AAGCCATCCTGGGCCACATGTGG - Intronic
1090309177 11:125719739-125719761 AGACCATCCTGGCCAACATGGGG + Intergenic
1090408395 11:126491222-126491244 CAGCCTTCCTGACCCTCAGGTGG - Intronic
1091446151 12:545326-545348 ATGCCCTCCTTGCCCTCATCTGG + Intronic
1091648724 12:2293487-2293509 AAGCCATCCTGGACCACGTGTGG - Intronic
1091701972 12:2669405-2669427 AAGCCGTCCTGGGCCGCATGTGG + Intronic
1091834762 12:3577598-3577620 AAGCCATCCTGGACCACATGTGG - Intronic
1091994990 12:4986540-4986562 AGACCATCCTGGCCGACATGGGG - Intergenic
1092397419 12:8140130-8140152 AAGCCATCCTGGGCCACATGTGG - Intronic
1092648945 12:10612149-10612171 AAGCCAGCCTGGGCAACATGGGG + Intronic
1092854479 12:12659740-12659762 AACCCATCCAGGCCCTGAAGGGG - Intergenic
1093143978 12:15542399-15542421 AAGCCATTCTGGGCAGCATGCGG + Intronic
1093396459 12:18689364-18689386 AAGCCACCATGGGCCACATGTGG - Intronic
1094800740 12:34031791-34031813 AAGCCATCCTGGGCTACATGCGG - Intergenic
1095113528 12:38326087-38326109 AAGCCATCCTGGGCTGCATGTGG - Exonic
1095299841 12:40571560-40571582 AGACCATCCTGGCCAACATGGGG + Intergenic
1095427495 12:42092931-42092953 AAGTCATCCTGGGCTGCATGCGG + Intronic
1095475441 12:42582727-42582749 AAGCCATCCTGGGTTGCATGTGG - Intronic
1096093931 12:48922071-48922093 CAGCCCTCCTGGGCCTCATTGGG - Exonic
1096333858 12:50738139-50738161 AGACCATCCTGGCCAACATGAGG + Intronic
1096391208 12:51230535-51230557 AAGCCATCCTGGGCCACATGTGG - Intergenic
1096394977 12:51258946-51258968 AAGCCAGCCTGGGCAACATGGGG + Intronic
1096423439 12:51480137-51480159 AGACCATCCTGGCCAACATGGGG - Intronic
1096566854 12:52489200-52489222 AAGCCATCCTGGGCTGCATGTGG - Intronic
1097012365 12:55962243-55962265 AGACCATCCTGGCCAACATGGGG + Intronic
1097830357 12:64217987-64218009 AAGCCATCCTGGACTGCATGTGG + Intronic
1098157118 12:67610725-67610747 AAGCCATCCTGGGCTACTTGTGG - Intergenic
1098247090 12:68531044-68531066 ATGCCATGCTAGCCCTCATGAGG + Intergenic
1098303245 12:69075924-69075946 AAGACATCCAGACCATCATGAGG + Intergenic
1098389028 12:69949568-69949590 AAGCCGTCCTGGGCCGCATGTGG - Intronic
1098606452 12:72396543-72396565 AGACCATCCTGGCCAACATGGGG + Intronic
1099205252 12:79719392-79719414 AAGCCATCCTGAGCCACATGTGG - Intergenic
1099363689 12:81741552-81741574 AAGCCATCCTGAGCCACTTGTGG - Intronic
1099622798 12:85025723-85025745 AGACCATCCTGGCCAACATGGGG - Intronic
1099818173 12:87674985-87675007 AAGCCCTCCTGGCTGTCATTTGG + Intergenic
1100235922 12:92660677-92660699 AAGCCATGCTGGGCTGCATGTGG + Intergenic
1100622319 12:96290097-96290119 AAGCCATCCTGGGCCATATATGG + Intronic
1100999333 12:100342110-100342132 AGACCATCCTGGCCAACATGGGG + Intergenic
1101129697 12:101676009-101676031 AAGCCATCCTGGGTTGCATGAGG - Intronic
1101437463 12:104676611-104676633 AGACCATCCTGGCCAACATGGGG - Intronic
1101703040 12:107193448-107193470 AAGCCTTACTGGGCCGCATGGGG - Intergenic
1101714866 12:107301883-107301905 AAGCTATCCTGGACCACATGTGG - Intergenic
1102545767 12:113654242-113654264 AAGCCATCCTGGGCCACATGTGG + Intergenic
1102625363 12:114231268-114231290 AAGCCATCCTGGGCCACATGTGG - Intergenic
1102787457 12:115616458-115616480 AAGTCACTCTGGCCATCATGGGG - Intergenic
1102842980 12:116146035-116146057 AAGCCGTTCTGGGCCTCATGCGG - Intronic
1103338548 12:120208740-120208762 AAACTATCCTGGGCCGCATGTGG - Intergenic
1103475602 12:121216175-121216197 AAGCCATCCTGGGCCGCATGCGG + Intronic
1103594507 12:122015928-122015950 AAGCCATCCTCAGCCTCCTGAGG - Intergenic
1103926267 12:124425016-124425038 AAGCCGTCCTGGGCTGCATGTGG - Intronic
1104391321 12:128392864-128392886 AAGCCATCCTGGGCCACCTGCGG + Intronic
1104658884 12:130594627-130594649 AAGCCATCCTGGGCTGCATGTGG + Intronic
1104768922 12:131348268-131348290 ACGGCCTCCTGGCCCTCAGGGGG - Intergenic
1104810831 12:131619380-131619402 ACGGCCTCCTGGCCCTCAGGGGG + Intergenic
1105833133 13:24183524-24183546 AAGCCATCTTGGGCTGCATGTGG - Intronic
1105909546 13:24849366-24849388 AAGCCATCCTGGGCTGCATGTGG - Intronic
1106105206 13:26726967-26726989 AAGCCGTCCTGGGCCTCATGCGG + Intergenic
1106204467 13:27577570-27577592 AAGCCTTCCTGGGCTGCATGTGG + Intronic
1106244828 13:27940194-27940216 AAGCTGTCCTGGGCCACATGTGG - Intergenic
1106286252 13:28320462-28320484 AAGCTGTCCTGGGCCACATGTGG - Intronic
1106425172 13:29621781-29621803 AGACCATCCTGGCCAACATGGGG + Intergenic
1106482481 13:30147381-30147403 CAGCCATCCTGGCCATCATAAGG + Intergenic
1106699539 13:32214363-32214385 AAGCTGTCCTGGGCCGCATGTGG - Intronic
1106755262 13:32816064-32816086 AAGCCATCCTGGGCTACATGTGG + Intergenic
1106764219 13:32897719-32897741 AAGACAACTTGGCCATCATGAGG - Intergenic
1106793659 13:33182664-33182686 AAGCCATCCTGGGCTGCATGCGG + Intronic
1106860558 13:33902988-33903010 AAGCCATCCTGGGCCGCATGTGG + Intronic
1107445436 13:40466358-40466380 AAGCCATCCTGGGCTGCATGCGG + Intergenic
1107871608 13:44751582-44751604 AAGCCATCCTGGGCTGCACGTGG + Intergenic
1108309494 13:49173086-49173108 AAGCTGTCCTGGGCCGCATGTGG + Intronic
1108482618 13:50890081-50890103 AAGCCATCTTGGCCATCTTCAGG + Intergenic
1108599706 13:51981918-51981940 AAGCCATCCTGGGCTGCATGTGG - Intronic
1108618122 13:52155879-52155901 AGGCCAGCCTGGCCAACATGGGG - Intronic
1108917323 13:55630893-55630915 AAGCCATCCTGGGCCTCATGAGG - Intergenic
1109165161 13:59025435-59025457 AGACCATCCTGGCCAACATGGGG - Intergenic
1110133619 13:72038033-72038055 AAGCCATCCTAGGCTGCATGTGG + Intergenic
1110253439 13:73406029-73406051 AAGCTGTCCTGGGCCACATGTGG + Intergenic
1110301098 13:73928054-73928076 AGACCATCCTGGCCAACATGGGG - Intronic
1110809111 13:79791848-79791870 AAGCCAGCCTGGCCCTGGGGTGG + Intergenic
1111191525 13:84813753-84813775 AAGCCGTTCTGGGCCGCATGTGG + Intergenic
1111347210 13:86974520-86974542 AGGGCATCCTGGCACTCTTGGGG + Intergenic
1111502217 13:89136631-89136653 AGACCATCCTGGCCAACATGGGG - Intergenic
1111520094 13:89390126-89390148 AAGGCATCCTGATCCACATGTGG - Intergenic
1111588959 13:90318771-90318793 AAGCCATCCTGGGCTGCATGTGG - Intergenic
1111665006 13:91255996-91256018 AAGCCATCTTGGGCTACATGTGG - Intergenic
1112290396 13:98141127-98141149 AAACCAGCCTGGCCAGCATGGGG - Intergenic
1112335505 13:98512084-98512106 AAACCAGCCTGGCCAACATGGGG - Intronic
1112392296 13:98996599-98996621 AAGCCATCCTGGGCCACATATGG - Intronic
1112394608 13:99017812-99017834 AAGCCAGCCTGGGCCACATGTGG + Intronic
1112429533 13:99338405-99338427 AAGCTGTCCTGGGCCACATGTGG + Intronic
1112834367 13:103495914-103495936 AGACCAGCCTGGCCCACATGGGG - Intergenic
1113354315 13:109563779-109563801 AAGCCATCCTGGGCCACATGTGG - Intergenic
1113456305 13:110451288-110451310 AAGCCGTCCTGGGCCGCATGTGG - Intronic
1113477948 13:110598669-110598691 AAGCCCTCCTGGGCCACATGTGG - Intergenic
1113602744 13:111582213-111582235 AAGCCATCCTGGGCTGCATGTGG + Intergenic
1113694524 13:112334764-112334786 AAGCCATCCTGGGCCACATGCGG + Intergenic
1114244119 14:20896544-20896566 AATCCATCCTGGGCCACATAGGG - Intergenic
1114264690 14:21066532-21066554 ACACCATCCTGGCCAACATGGGG - Intronic
1114430276 14:22654890-22654912 AAGCCTTCCCAGCCATCATGGGG - Intergenic
1114494212 14:23121444-23121466 GAACCTTCCTGGCCCTCATTTGG + Intergenic
1115612735 14:35064186-35064208 AGACCAGCCTGGCCATCATGGGG + Intronic
1115979985 14:39040472-39040494 ATGCCATCCTGGCCCTGTTCAGG + Intronic
1116612163 14:47089573-47089595 AGACCATCCTGGCCAACATGGGG - Intronic
1116991129 14:51277955-51277977 AAGCTGCCCTGGGCCTCATGGGG - Intergenic
1117177089 14:53155893-53155915 AAGCCATCCTGGGCTGCATATGG + Intergenic
1117235883 14:53774085-53774107 AAGCCTTCCTGGGCCACATGTGG - Intergenic
1117804634 14:59478983-59479005 AAGCCATCCTGGGCTGCATGTGG + Intronic
1117829055 14:59732612-59732634 AGGCCCTGGTGGCCCTCATGAGG - Intronic
1117874998 14:60243091-60243113 AAGCCATCCTGGGCTGTATGCGG - Intergenic
1118156112 14:63243536-63243558 AGACCATCCTGGCCAACATGGGG - Intronic
1118567013 14:67152764-67152786 AGACCATCCTGGCCAACATGGGG + Intronic
1118649430 14:67874343-67874365 AAGCCATCCTGGGCTGTATGCGG - Intronic
1118898557 14:69967394-69967416 AAGCGATCCTGGGCAGCATGTGG - Intronic
1119055185 14:71412227-71412249 AAGCCATCCTGTGCCACATGTGG - Intronic
1119151977 14:72369117-72369139 AAGCCATCCTGAGCCACATGTGG + Intronic
1119356733 14:74013413-74013435 AAACCATCCTGGGCTACATGCGG - Intronic
1119363861 14:74074483-74074505 AGACCATCCTGGCCAACATGGGG - Intronic
1119678098 14:76571347-76571369 AAGCCTTGCTGGGCCACATGTGG - Intergenic
1119760089 14:77144322-77144344 AAACCATCCTGGCCAACATGGGG + Intronic
1119799958 14:77435114-77435136 AAGCTTTCCTGGCCCTCACCAGG - Intronic
1119876467 14:78063961-78063983 AAGCCATCCTGGGCTGCATATGG + Intergenic
1120077148 14:80172035-80172057 AAGCCATCCTGGGCTGCATGCGG - Intergenic
1120541872 14:85761048-85761070 AAGCCATCCTGGGCCACATGTGG - Intergenic
1120687652 14:87556676-87556698 AGACCAGCCTGGCCCACATGGGG + Intergenic
1120912314 14:89678473-89678495 AAGCCATCCTGGGCCACATATGG + Intergenic
1121020916 14:90579597-90579619 AAACCAGCCTGGCCAACATGGGG + Intronic
1121037695 14:90719939-90719961 AAGTCATCCTGGGTCGCATGTGG - Intronic
1121191643 14:92035944-92035966 AACCCATCCTGGGCCACATGTGG + Intronic
1122171800 14:99882738-99882760 AAGTCGTCCTGGGCCGCATGTGG + Intronic
1122195295 14:100080280-100080302 AAGCTGTCCTGGGCCACATGCGG + Intronic
1122285328 14:100648486-100648508 AAGCTGTCCTGGGCCACATGAGG + Intergenic
1122295015 14:100700568-100700590 GATCCATCCTTGGCCTCATGAGG + Intergenic
1122430580 14:101637911-101637933 AGACCATCCTGGCCAACATGGGG - Intergenic
1122495097 14:102147927-102147949 AGGCCAGCCTGGCCAACATGGGG - Intronic
1122732138 14:103808526-103808548 AAGCTGTCCTGGGCCTCCTGTGG + Intronic
1122911510 14:104830696-104830718 AAACCAGCCTGGCCAACATGGGG - Intergenic
1122919761 14:104875178-104875200 AAGCCGTGCTGGCACTCAGGAGG + Intronic
1123438482 15:20272856-20272878 CAGCCTTCCTGGCCTTCTTGTGG - Intergenic
1123886195 15:24730396-24730418 AAGCCGTCCTGGGCCACATGTGG + Intergenic
1124143785 15:27101928-27101950 AAGCCATCCTGGGCTGCACGTGG + Intronic
1124459490 15:29876162-29876184 AAGCCATCCTGGGCCACATGTGG - Intronic
1125258777 15:37798264-37798286 AAGCTGTCCTGGGCTTCATGTGG - Intergenic
1125315263 15:38424815-38424837 AAGCCATCCTGGGTCGCATGTGG + Intergenic
1125851886 15:42912045-42912067 AAGCCGTCCTGGGCCACGTGCGG + Intronic
1125981734 15:44008462-44008484 AGACCAGCCTGGCCATCATGAGG - Intronic
1126066791 15:44831878-44831900 AAGCCATCCTGGGCTGCATGTGG - Intergenic
1126093040 15:45068677-45068699 AAGCCATCCTGGGCTGCATGTGG + Intronic
1126201853 15:45995461-45995483 AGACCATCCTGGCCAACATGGGG + Intergenic
1126257389 15:46643891-46643913 AGGCCATTCTGGCCAACATGGGG - Intergenic
1126298132 15:47165102-47165124 AAGCCATCCTTGCATTCCTGGGG + Intergenic
1127369290 15:58322254-58322276 AAGCCGTCCTGGGCCACATGTGG + Intronic
1127496753 15:59520017-59520039 AAGCCATCCTGGGTCGCATGTGG - Intronic
1127656495 15:61060910-61060932 AAGCCATCCTGGGCAGCGTGCGG + Intronic
1128003780 15:64219051-64219073 AGGCCAGCCTGGCCAACATGGGG - Intronic
1128174497 15:65542873-65542895 AGACCATCCTGGCCAACATGGGG + Intronic
1128227223 15:66010545-66010567 AAGCCATCCTGGGCTGCATGCGG + Intronic
1128295216 15:66513127-66513149 AAACCAGCCTGGCCAACATGGGG - Intronic
1128439355 15:67689935-67689957 AAGCCGTCCTGTGGCTCATGTGG - Intronic
1128606695 15:69041783-69041805 AAGCCGTCCTGGGCCCCATGCGG - Intronic
1128894807 15:71363053-71363075 AAGCCATCCTGGGCTGCATGTGG + Intronic
1129207461 15:74045482-74045504 AAACCAAACTGCCCCTCATGAGG + Exonic
1129375159 15:75125557-75125579 AAGCCATCCTGGGCCGCATGTGG - Intergenic
1129499343 15:76020671-76020693 AAGCCATTCTGGGCTGCATGCGG + Intronic
1129566255 15:76626065-76626087 AAGCCATCCTGGGCCACATGCGG + Intronic
1129876040 15:78976460-78976482 AAACCATCCTGGGCCATATGCGG + Intronic
1130371638 15:83289518-83289540 AAGCTCTCCTGGACCACATGTGG - Intergenic
1130403309 15:83577260-83577282 GAGCCATCCTGGGCCACATGTGG + Intronic
1131244813 15:90781738-90781760 AAACCATCCTGGGCTGCATGTGG + Intronic
1131393768 15:92070442-92070464 AGACCAGCCTGGCCCACATGGGG + Intronic
1131574997 15:93579958-93579980 AAGCCATCCTGGGCTGCATGTGG - Intergenic
1132044697 15:98553685-98553707 AAGCCATTCTGGCCTTCCAGAGG - Intergenic
1132416581 15:101624577-101624599 AAGCCATCCTGGCCCTCATGTGG + Intronic
1132634253 16:935633-935655 AAGCCATCCTGAGCCGCGTGTGG + Intronic
1132756928 16:1490029-1490051 ATACCAGCCTGGCCCACATGGGG - Intergenic
1132832851 16:1937752-1937774 AAACCAGCCTGGCCAACATGAGG - Intergenic
1133719349 16:8479965-8479987 AGACCATCCTGGCCAACATGGGG + Intergenic
1133743893 16:8673270-8673292 AGACCAGCCTGGCCATCATGGGG - Intergenic
1134278501 16:12797775-12797797 AAGCCATCCTGGGCCACATGTGG + Intronic
1134351975 16:13446143-13446165 AGACCATCCTGGCCAGCATGGGG - Intergenic
1134552884 16:15146143-15146165 CTGCCATCCTGGCCCACGTGTGG - Intergenic
1134604530 16:15560005-15560027 AAGCCATCCTGGGCCTAATTTGG + Intronic
1134745804 16:16587448-16587470 AAACCAGCCTGGCCAACATGGGG - Intergenic
1134783367 16:16918736-16918758 AGACCATCCTGGCCAACATGGGG + Intergenic
1134999675 16:18766294-18766316 AAACCAGCCTGGCCAACATGGGG + Intergenic
1135237724 16:20774439-20774461 AGACCATCCTGGCCAACATGGGG - Intronic
1135334056 16:21586079-21586101 AAGCCATCCCGGGCCGCATGTGG - Intergenic
1135396895 16:22138494-22138516 AAACCATTCTGGCCCCCAGGGGG - Exonic
1135542502 16:23342727-23342749 AAGCCATCCTGGGCTGCCTGTGG + Intronic
1135730240 16:24888993-24889015 AGACCAGCCTGGCCCACATGGGG - Intronic
1135977459 16:27118292-27118314 AAGCCATTCTGGGCTGCATGTGG - Intergenic
1136518563 16:30782379-30782401 AAGCCCTCCTGACCCTCCGGCGG + Exonic
1136653657 16:31695561-31695583 AAGCCATCCTGGGTCCCATGTGG + Intergenic
1136985743 16:35102662-35102684 AAGCTATCCTGGGCTGCATGCGG + Intergenic
1136988228 16:35133425-35133447 AGGCCAGCCTGGCCAACATGAGG - Intergenic
1137242951 16:46673865-46673887 AAGCCATCCTGGGCTGCATGCGG - Intronic
1137305111 16:47191322-47191344 AAGCCACCCTGGGCCACATGTGG - Intronic
1137816815 16:51405884-51405906 AAGCCATCCTGGGCCACATGTGG - Intergenic
1137886741 16:52112496-52112518 AAGCCATTGTAGCCTTCATGGGG - Intergenic
1138030711 16:53557512-53557534 AAGCCATCCTGGGCTGCATGTGG + Intergenic
1138222190 16:55261208-55261230 AAGCCATCCTGGGCCACATGTGG - Intergenic
1138323959 16:56145278-56145300 TAGCCTTCCTGGGCCGCATGTGG - Intergenic
1138488288 16:57360676-57360698 AAGCCATCCTGGCAGGCATCTGG - Intronic
1138636470 16:58342660-58342682 AGACCAGCCTGGCCATCATGGGG - Intronic
1138729462 16:59178822-59178844 AAGCCATCCTGGGCTACATATGG + Intergenic
1139082582 16:63541128-63541150 AAACCATCTTGGGCCGCATGTGG - Intergenic
1140144668 16:72295018-72295040 AAGCCAACCTGGGCCACATGCGG + Intergenic
1140404773 16:74701427-74701449 AGACCATCCTGGCCAACATGGGG + Intergenic
1140694518 16:77519195-77519217 AGACCATCCTGGCCAACATGGGG - Intergenic
1140742053 16:77950208-77950230 AAACCAGCCTGGCCAACATGGGG + Intronic
1140960633 16:79908851-79908873 AAGCCCTCCTGGGCCTCATCTGG - Intergenic
1141401975 16:83756473-83756495 AAGCCATTCTGGGCCACATATGG - Intronic
1141605052 16:85148044-85148066 AAACCATCCTGGCCAACATGTGG - Intergenic
1141889091 16:86914716-86914738 AAGCCCTCGTCACCCTCATGGGG - Intergenic
1142544165 17:687375-687397 AGACCATCCTGGCCAACATGGGG + Intronic
1142560951 17:808491-808513 AGACCATCCTGGCCAACATGGGG - Intronic
1142957915 17:3533695-3533717 AGACCATCCTGGCCAACATGGGG - Intronic
1143035653 17:3995257-3995279 AAGCCAACCTTGCATTCATGTGG + Intergenic
1143251619 17:5527323-5527345 AAGCCATCCTGGGCCGCATGTGG + Intronic
1143640389 17:8193091-8193113 AGACCATCCTGGCCAACATGGGG + Intergenic
1144258686 17:13496416-13496438 AAGACTTCCTGGGCCTCAAGAGG - Exonic
1144345466 17:14345408-14345430 AAGACTTCCTGGGCCTCAAGAGG + Exonic
1144514844 17:15910251-15910273 AAGCCACCCTGGGCTGCATGTGG - Intergenic
1144565472 17:16355484-16355506 AAACCAGCCTGGCCAACATGGGG + Intergenic
1145234190 17:21197202-21197224 AAGCCATCGTGGGCTGCATGAGG - Intergenic
1145745532 17:27316964-27316986 AAGCCATCCTGGGCCACATGTGG + Intergenic
1145945293 17:28769495-28769517 AGACCATCCTGGCCAACATGGGG - Intronic
1146070307 17:29674881-29674903 AAGCCATCCTGGGCTGCATGTGG + Intronic
1146251720 17:31351779-31351801 AAGCCATCCTGGGCTGCGTGCGG - Intronic
1146518358 17:33507195-33507217 AAGCCCTCCTGCCTGTCATGAGG - Intronic
1146757120 17:35442641-35442663 AGACCATCCTGGCCAACATGGGG - Intronic
1147536192 17:41324542-41324564 AAGCCATCCTGGCCATCTGTGGG + Intergenic
1147575521 17:41596679-41596701 AAGCCATCCATGCCCTCTTTTGG - Intergenic
1147675914 17:42205477-42205499 CAGCCTCCCTGGCCCTCCTGAGG + Intronic
1147782561 17:42954153-42954175 AAACCAGCCTGGCCAACATGGGG + Intronic
1147846238 17:43405945-43405967 CTGCCATCTTTGCCCTCATGAGG + Intergenic
1148076816 17:44941888-44941910 CAGCCACACTGGCCCTCAGGAGG - Intronic
1148411572 17:47471765-47471787 CAGCCAGCCTGGCCAACATGGGG + Intergenic
1148631307 17:49111557-49111579 AAGCCGTCCTGGGCCTCATGTGG + Intergenic
1148988724 17:51646974-51646996 AAGAGATCCTGGCCTGCATGGGG - Intronic
1149425201 17:56548245-56548267 AGACCATCCTGGCCAACATGGGG + Intergenic
1149508506 17:57216564-57216586 TAGCCATCCTGTCCCACATAAGG + Intergenic
1149560052 17:57602131-57602153 AAGCCATCCTGGGCCGCATATGG - Intronic
1149711724 17:58749173-58749195 AAGCCGTCCTGGGCTGCATGTGG - Intergenic
1149715436 17:58784721-58784743 AGACCATCCTGGCCAACATGGGG - Intronic
1149880226 17:60282550-60282572 AGACCATCCTGGCCAACATGAGG - Intronic
1150425014 17:65070284-65070306 AGACCATCCTGGCCAACATGGGG + Intergenic
1150563492 17:66316442-66316464 AAGCCATCCTGGGCTGCATGCGG - Intronic
1150757952 17:67933052-67933074 AGACCATCCTGGCCAACATGGGG + Intronic
1150843231 17:68628902-68628924 AAGCCATCCTGGGCCACATGTGG - Intergenic
1151636892 17:75355681-75355703 AAGCCATCCTGGGCCACATGTGG + Intronic
1151970918 17:77456975-77456997 GAGCCAGCCTGGCCATCCTGAGG + Intronic
1152011263 17:77719819-77719841 AAGCCATCCTGGGCTGCATGCGG + Intergenic
1203168748 17_GL000205v2_random:126047-126069 AGACCATCCTGGCCAACATGGGG + Intergenic
1152960136 18:74787-74809 AGACCAGCCTGGCCCACATGAGG + Intergenic
1153129616 18:1840252-1840274 AAACCAGCCTGGCCAACATGAGG + Intergenic
1153407154 18:4753640-4753662 AAGCCGTCCTGGGCCACATGTGG - Intergenic
1153740264 18:8118443-8118465 AAGCCATCCGGGGCTGCATGTGG - Intronic
1153782863 18:8509644-8509666 AGACCATCCTGGCCAACATGGGG + Intergenic
1153937834 18:9946390-9946412 AAGCCATCATGGGCCACGTGTGG - Intronic
1154256443 18:12784781-12784803 AGACCATCCTGGCCAACATGGGG - Intergenic
1154472596 18:14719623-14719645 AGGCCATCTTGGCCAACATGGGG - Intergenic
1154969680 18:21394893-21394915 AAACCAGCCTGGCCAACATGGGG + Intronic
1155119396 18:22802947-22802969 AAGCCATCCTGGGCCTCATGTGG - Intronic
1155201567 18:23522401-23522423 AAGCTGTCCTGGGCCACATGTGG - Intronic
1155295886 18:24384373-24384395 AGGCCAGCCTGGCCAACATGGGG + Intronic
1155378562 18:25190087-25190109 AAGCCAGCATTGCCCACATGAGG + Intronic
1155703844 18:28782987-28783009 AAACCATCCTGGGCCACATGCGG - Intergenic
1155715659 18:28940471-28940493 AAGCTGTCCTGGGCCGCATGAGG + Intergenic
1155905067 18:31440708-31440730 AAGCTGTCTTGGCCCACATGTGG - Intergenic
1156317297 18:35982160-35982182 AGGTCATCCTGGCCAACATGGGG - Intergenic
1156722303 18:40084932-40084954 AAGCCATCCTGTGCTGCATGCGG - Intergenic
1156803365 18:41145704-41145726 AAGACCTGCTGGCCCTCTTGGGG - Intergenic
1156803611 18:41149131-41149153 AAGCCATCCTGGGCCACATGTGG + Intergenic
1156879725 18:42062367-42062389 AAGCTGTCCTGGGCCACATGTGG - Intronic
1157473472 18:48007397-48007419 AAGCCATCCTGGGCCTCACGCGG + Intergenic
1157890908 18:51416863-51416885 AGACCATCCTGGCCAACATGGGG + Intergenic
1157953462 18:52066793-52066815 AAGGCATCCTGGGCCACATTTGG - Intergenic
1157958049 18:52121107-52121129 AAGTCATCCTGGACCACATGTGG + Intergenic
1158030518 18:52958902-52958924 AAGCCATCCTGGGCTGCATATGG - Intronic
1158093389 18:53741961-53741983 TAGCTATCCTGGGCCACATGCGG - Intergenic
1158376933 18:56881782-56881804 AGGCCAGCCTGGCCAACATGGGG - Intronic
1158386993 18:57005874-57005896 AAGCCATCCTGGGCCGCATGTGG + Intronic
1159104516 18:63990272-63990294 AAACCAGCCTGGCCAACATGGGG - Intronic
1159109612 18:64041903-64041925 AGGCCAACCTGGCCAACATGGGG - Intergenic
1159115640 18:64109895-64109917 AAGCTATCCTGGGCCACGTGCGG - Intergenic
1159250888 18:65874994-65875016 AAGCCATCCTGGGCCACATGTGG - Intronic
1159399314 18:67910128-67910150 AAGCCAGCTTGGGCCACATGTGG + Intergenic
1159440926 18:68478979-68479001 AAGCCATCCTGGGACACATGTGG - Intergenic
1159449195 18:68578076-68578098 AAGCCATCCTGGACCACACGCGG + Intergenic
1159988590 18:74875021-74875043 AAGGGATCCTGGTCCTCCTGGGG - Intronic
1160205835 18:76830709-76830731 AAGCCGTCCTGGGCTGCATGTGG + Intronic
1160227711 18:77024171-77024193 AAGGCATCCTGGGCTGCATGCGG - Intronic
1160388952 18:78515833-78515855 AAGCCATTTCGGGCCTCATGTGG + Intergenic
1160629896 18:80239521-80239543 AAGCCATCCTGTTCCACATGTGG + Intronic
1161190421 19:2951747-2951769 AAGCCATCCTGGGCTTCATCCGG + Intergenic
1161315972 19:3617859-3617881 CAGCCATCCTGTCCCTCCAGTGG - Intronic
1161811090 19:6471839-6471861 AAACCAGCCTGGCCAACATGGGG - Intronic
1161819189 19:6518851-6518873 AAACCAGCCTGGCCAACATGGGG - Intergenic
1161826333 19:6568673-6568695 AAACCATCCTGGCTAACATGGGG + Intergenic
1163404560 19:17114000-17114022 AGGCCATCCTGTGCATCATGGGG + Intronic
1163540112 19:17903642-17903664 AGACCATCCTGGCCAACATGGGG - Intergenic
1165001119 19:32763402-32763424 CAGCCATCCTGTCCCACATAAGG - Intronic
1165034454 19:33022756-33022778 CAGCCTTCCTGGCCTTCTTGTGG - Intronic
1165352805 19:35285413-35285435 AAGCCATCCAGGGCTGCATGTGG - Intergenic
1165480834 19:36063141-36063163 AGACCATCCTGGCCAACATGGGG - Intronic
1165584684 19:36903690-36903712 AGACCATCCTGGCCAACATGGGG + Intronic
1165593417 19:36990414-36990436 AGACCAGCCTGGCCATCATGGGG + Intronic
1165892663 19:39123670-39123692 AGACCATCCTGGCCAACATGGGG + Intergenic
1166737468 19:45094526-45094548 AAACCAGCCTGGCCAACATGGGG + Intronic
1166920068 19:46223132-46223154 AGACCACCCTGGCCATCATGGGG + Intergenic
1167014643 19:46832865-46832887 AGACCATCCTGGCCAACATGGGG + Intergenic
1167729333 19:51241905-51241927 AAACCAGCCTGGCCAACATGCGG - Intronic
1167791362 19:51684785-51684807 AAGCCATCCTGGGCCACATGAGG + Intergenic
1167894213 19:52568171-52568193 AAACCAGCCTGGCCAACATGGGG + Intronic
1168591655 19:57641061-57641083 AAGACTTCCTGGCCAACATGAGG + Exonic
1168675370 19:58273992-58274014 AGACCATCCTGGCCAACATGGGG - Intronic
925571939 2:5321755-5321777 AAGCTGTCCTGGGCCACATGTGG + Intergenic
925642796 2:6003094-6003116 AAGCCATCCTGGGTTGCATGTGG + Intergenic
925750183 2:7082740-7082762 AAGCCATCCTGGGCCACATGAGG + Intergenic
926290637 2:11526754-11526776 AAACCAGCCTGGCCAACATGGGG - Intergenic
926357269 2:12052631-12052653 AGACCATCCTGGCCAACATGGGG + Intergenic
926791304 2:16574679-16574701 AAGCCATGGTGGCTCACATGTGG + Intronic
927070543 2:19524387-19524409 CAGCCTTCCTGGCACTCAGGTGG + Intergenic
927081392 2:19634226-19634248 AAGTCATTCTGGCCGCCATGAGG - Intergenic
927583533 2:24277915-24277937 AAGCTGTCCTGGGCCGCATGTGG + Intronic
927584571 2:24289717-24289739 AAGCCATCCTGGGCCGCATGTGG - Intronic
927837974 2:26416338-26416360 AGACCATCCTGGCCAACATGGGG - Intronic
927855379 2:26524307-26524329 AGACCATCCTGGCCAACATGGGG + Intronic
928118067 2:28562341-28562363 AGACCATCCTGGCCAACATGGGG + Intronic
928130587 2:28646359-28646381 AAACCATCCTGGGACGCATGCGG - Intergenic
928348389 2:30521703-30521725 AGACCATCCTGGCCAACATGAGG - Intronic
928570345 2:32601069-32601091 AAGCCATCCTGGGCCGCATGTGG + Intronic
928749456 2:34454954-34454976 AGGCCATCCTGGCCAACATGGGG - Intergenic
928916035 2:36471794-36471816 AAGCCATCCTAGGCCTCATGTGG + Intronic
929572263 2:43030095-43030117 CAGCCACACTGGCCCTCATTGGG + Intergenic
929647426 2:43641418-43641440 AAGCCATCCTGGGCTGCCTGTGG - Intronic
929858532 2:45655273-45655295 AAGCCATCCCGGGCCACATGTGG - Intronic
929969824 2:46564498-46564520 AAGCCATCCTCGTCCTCAGATGG + Intronic
929972844 2:46598458-46598480 AAGCCATCCTGGGCCACATGTGG - Intronic
930187243 2:48422104-48422126 AAGCCGTCCTGGGCTGCATGTGG - Intergenic
930219153 2:48728017-48728039 AAGCCATCCTGGGCCACATGTGG - Intronic
930383570 2:50662506-50662528 AAGCTGTCCTGGGCCTCCTGCGG - Intronic
930395707 2:50821209-50821231 AAACCATCCTGGGCTGCATGGGG - Intronic
930868559 2:56146943-56146965 AAGCCATCCTAGGCCACATGTGG - Intergenic
930906051 2:56569350-56569372 AAGCCGTCCTGGGCTGCATGTGG + Intergenic
930949213 2:57116966-57116988 AAGCCATCCTGAGCCACATGGGG - Intergenic
931399067 2:61913969-61913991 AGACCATCCTGGCCAACATGGGG + Intronic
932195146 2:69776813-69776835 AAGCTGTCCTGGGCCACATGTGG + Intronic
932285775 2:70530563-70530585 AAGCCCTCCTGGGCCACAGGCGG + Intronic
933038618 2:77431873-77431895 AGACCATCCTGGCCAACATGGGG + Intronic
933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG + Intronic
933444451 2:82361020-82361042 AAGCCATCCTGAGCCACATGTGG - Intergenic
934495438 2:94792742-94792764 AAACTATCCTGGCCAACATGGGG + Intergenic
935036156 2:99376070-99376092 AAGCCATCCTGGGCTGCATGTGG - Intronic
935279675 2:101506556-101506578 AGGCCCACCTGGCCCTTATGAGG + Intergenic
935422178 2:102880641-102880663 AAGCTGTCCTGGGCCACATGCGG - Intergenic
935684848 2:105674127-105674149 AAGCTGTCCTGGGCCACATGCGG + Intergenic
935759598 2:106308777-106308799 AAGCCATCTTGGGCCGCATGTGG - Intergenic
936049403 2:109211839-109211861 AAACCAGCCTGGCCAACATGGGG - Intronic
936258818 2:110939706-110939728 AAGCCATCCAGGGCTGCATGAGG - Intronic
936276052 2:111098386-111098408 AAGTTATCCTGGGCCTCATGTGG + Intronic
936443710 2:112579007-112579029 AGACCAGCCTGGCCATCATGGGG + Intergenic
937182009 2:120005097-120005119 AAACCAGCCTGGCCAACATGGGG - Intergenic
937454201 2:122027264-122027286 AAGCTGTCCTGGGCCGCATGGGG + Intergenic
937605407 2:123794722-123794744 AACCCATCCTGGGCCACATGTGG - Intergenic
937887082 2:126907310-126907332 AAGCAATCCTTGCCCTCTGGAGG - Intergenic
937995889 2:127694753-127694775 AGACCATCCTGGCCAACATGCGG - Intergenic
938039888 2:128066975-128066997 AAACCAGCCTGGCCAACATGGGG + Intergenic
938225669 2:129614203-129614225 AAGCCATTCTGGGCTGCATGCGG - Intergenic
938672536 2:133599728-133599750 AAGCCCTTCTTGCCCTCCTGGGG + Intergenic
938737159 2:134196679-134196701 AAGCCGTCCTGGGCCACAGGTGG - Intronic
938868456 2:135449419-135449441 AGACCATCCTGGCCAACATGCGG + Intronic
939325262 2:140679835-140679857 GAGCCATCCTGGGCTGCATGTGG - Intronic
939538489 2:143462999-143463021 AAGCCATCCTGGGCCACAGGAGG - Intronic
939687966 2:145223311-145223333 AAGCCATCCTGGGACCCATGTGG + Intergenic
940158441 2:150684094-150684116 AAGCCTTCCTGGGCTGCATGTGG - Intergenic
940238760 2:151540361-151540383 AAGCCCTCTTGGCTCTGATGAGG + Exonic
940351811 2:152699193-152699215 AAGCTGTCCTGGGCCACATGTGG - Intronic
940441010 2:153716268-153716290 AAGCCATCCTGGGCCACGTGTGG - Intergenic
941226780 2:162859684-162859706 AAGCCTTCCTGGGCCACATGTGG - Intergenic
941379015 2:164768345-164768367 AAACCATCCTGGGCTGCATGTGG - Intronic
941461962 2:165782456-165782478 AAGCCATCCAGGGTCGCATGTGG + Intronic
941585404 2:167352165-167352187 AGACCATCCTGGCCAACATGGGG - Intergenic
941633607 2:167911045-167911067 AGGCCAGCCTGGCCAACATGCGG - Intergenic
941702781 2:168622330-168622352 AAGCCGTCCTGGCCTGCATGTGG + Intronic
941922152 2:170862168-170862190 AGACCATCCTGGCCAACATGGGG - Intergenic
942326601 2:174781600-174781622 ACAACAGCCTGGCCCTCATGAGG + Intergenic
942412544 2:175725930-175725952 AAGCCGTCCTGGTCTGCATGTGG - Intergenic
942435371 2:175967085-175967107 AAGCTATCTTGGGCCACATGTGG - Intronic
942674018 2:178407423-178407445 AAGCTGTCCTGGGCCACATGTGG - Intergenic
942891252 2:180991565-180991587 AAGACATCCTGGCCACCAGGTGG - Intronic
943034319 2:182722740-182722762 AAACCAGCCTGGCCAACATGGGG + Intronic
943069941 2:183128675-183128697 AAGCCATCCTGGGCTTCATGCGG + Intronic
944383715 2:199141354-199141376 CAGGCATCCCTGCCCTCATGGGG + Intergenic
944749704 2:202696482-202696504 AAACCATCCTGGTCCTCATGAGG + Intronic
944908441 2:204285732-204285754 AAGCCATCCTGGGCTGCATGTGG - Intergenic
945386205 2:209203984-209204006 AAGCCATCCTGGGCCACATGCGG + Intergenic
945415978 2:209573490-209573512 AAACCAGCCTGGCCAACATGGGG - Intronic
945426852 2:209716455-209716477 AAGTCATCCTGCACCACATGTGG - Intronic
945775356 2:214100544-214100566 AAGACATCAGGGCCCACATGAGG - Intronic
945953407 2:216062242-216062264 AAACCAGCCTGGCCAACATGGGG - Intronic
946186622 2:217984349-217984371 AAGCCATCCTGAGCCACATGTGG - Intronic
946252686 2:218423195-218423217 AGACCAGCCTGGCCCACATGGGG + Intronic
946424917 2:219589199-219589221 AAGTCATCCTGGGCCACATATGG - Intergenic
946489285 2:220132170-220132192 AAGGCATCCTCAGCCTCATGTGG - Intergenic
946494502 2:220182098-220182120 AAGCCTTTCTGGGCCACATGTGG - Intergenic
946677221 2:222173326-222173348 AAGTCATGCTGGTCCTTATGAGG + Intergenic
947115448 2:226765446-226765468 AAGTCTTCCTGGCCCTTATGTGG - Intronic
947922586 2:233891066-233891088 AAGCCATTCTGGACTGCATGTGG - Intergenic
947967986 2:234298269-234298291 AGACCATCCTGGCCAACATGGGG + Intergenic
948012136 2:234657280-234657302 AAGCCTTCCTGGGCCGCCTGTGG - Intergenic
948093060 2:235311896-235311918 AAGCCATCCTGGGCTGCATGTGG - Intergenic
948295920 2:236860406-236860428 AAGCCATCCCAGGCCGCATGTGG - Intergenic
948789131 2:240368311-240368333 AAACCACCCTGGGCCACATGGGG + Intergenic
1169229357 20:3877172-3877194 ACACCATCCTGGCCAACATGGGG + Intergenic
1169311509 20:4545916-4545938 AAGCCATCCTGGGCTGCATGTGG + Intergenic
1169348743 20:4851110-4851132 AAGCCATCCTGGGTCGCATGTGG + Intergenic
1169394167 20:5215061-5215083 AGGCCAACTTGACCCTCATGAGG + Intergenic
1169792893 20:9430168-9430190 AAGCCATCCTGGGCCACATGTGG + Intronic
1170253725 20:14316486-14316508 AAGCCATCCTGGGCTGCCTGTGG - Intronic
1170324716 20:15144025-15144047 AAGCCATCCTGGGCCTCATGTGG + Intronic
1170381077 20:15760315-15760337 AAGCCCACCTGGCTCTCTTGAGG - Intronic
1170903072 20:20484975-20484997 AAGTCATCCAGGGCCGCATGTGG - Intronic
1170913982 20:20604601-20604623 AAGCCATTCTTGGCTTCATGTGG - Intronic
1172103977 20:32504797-32504819 AGACCATCCTGGCCAACATGAGG - Intronic
1172166276 20:32901518-32901540 AGGCCCTCCTGGCCCTGGTGAGG - Intronic
1172746120 20:37210728-37210750 AAACCAGCCTGGCCAACATGGGG - Intronic
1172827966 20:37806361-37806383 TAGCCATCCTGGTGCTCTTGTGG - Intronic
1173143384 20:40504080-40504102 AAGCCATCTTAGGCCTAATGAGG - Intergenic
1173597278 20:44267023-44267045 AAGCCATCCTGGGCTGCATGTGG + Intronic
1174066546 20:47869887-47869909 AAGCCATTCTGGGCCACATGTGG + Intergenic
1174403597 20:50289719-50289741 TAGCCATCCTGGGCCACATGTGG + Intergenic
1174488244 20:50874552-50874574 CAACCATCCCAGCCCTCATGGGG - Intronic
1175051214 20:56157281-56157303 TATCCATCCTGGCCCTTAAGTGG + Intergenic
1175674598 20:60935916-60935938 AAGACAGCCTGGCCCTGATCTGG + Intergenic
1175796456 20:61774230-61774252 AAACCTGCCTGGCCCTCAAGGGG - Intronic
1176403011 21:6333092-6333114 AGACCATCCTGGCCAACATGGGG - Intergenic
1176434146 21:6656012-6656034 AGACCATCCTGGCCAACATGGGG + Intergenic
1176801893 21:13438268-13438290 AGGCCATCCTGGCCAACATGGGG + Intergenic
1177270825 21:18847837-18847859 AGACCATCCTGGCCAACATGGGG + Intergenic
1177394310 21:20512830-20512852 AAGCCACCCTGGGCCACATGTGG + Intergenic
1177447725 21:21219081-21219103 AAGCCATCCTGGGCTGCATGTGG - Intronic
1178150260 21:29786185-29786207 AGACCATCCTGGCCAACATGGGG - Intronic
1178337186 21:31753864-31753886 AGGCCAACCTGGGCCACATGGGG + Intergenic
1178401623 21:32291137-32291159 AAGCCATCCTGGGCCACATGTGG + Intergenic
1178638404 21:34325828-34325850 AAGCCATCCTGGGCTGCATATGG - Intergenic
1178711253 21:34918707-34918729 AGACCATCCTGGCCAACATGGGG + Intronic
1179087687 21:38234198-38234220 AAGCCATCCTGGGCTACATGTGG - Intronic
1179427597 21:41294269-41294291 AAGCCCTCCTGGTCCTCCTGAGG + Intergenic
1179578166 21:42320637-42320659 AAGCCATCCTGGGTTGCATGTGG - Intergenic
1179590405 21:42404259-42404281 AAGCTGTCCTGGGCCTCATGTGG - Intronic
1179776923 21:43670606-43670628 AAGCCATCCTGGGCCACATGTGG - Intronic
1179988871 21:44935505-44935527 CAGACATGCTGGGCCTCATGGGG - Intronic
1180028078 21:45180017-45180039 AGGCCAGCCCGGCCCTCAGGAGG - Intronic
1181067320 22:20313033-20313055 TAGCCAGCCTGGCCTGCATGGGG - Intergenic
1181265910 22:21630361-21630383 AGGCCAGCCTGGCCAACATGGGG + Intergenic
1181395668 22:22619460-22619482 AAGCCATCCTAGGCTGCATGTGG + Intergenic
1181447332 22:22987227-22987249 ATCCCATCCCTGCCCTCATGAGG - Intergenic
1181958549 22:26605940-26605962 AAGCCATCCTGAGCCACATGTGG - Intronic
1181996784 22:26889204-26889226 AGACCATCCTGGCCAACATGGGG + Intergenic
1182011093 22:27001229-27001251 AAGCCGACCTGGACCACATGTGG - Intergenic
1182217655 22:28732443-28732465 AGGCCATCCTGGCCAACATGGGG - Intronic
1182324445 22:29501623-29501645 AGACCATCCTGGCCAACATGGGG + Intergenic
1183030697 22:35102217-35102239 AAGCCATCCTGGGCCGCATGTGG + Intergenic
1183140157 22:35930217-35930239 AAACCAGCCTGGCCAACATGGGG - Intronic
1183340998 22:37281467-37281489 AAGGTAACCTTGCCCTCATGGGG + Intergenic
1183410367 22:37651526-37651548 AAACCAGCCTGGCCAACATGGGG - Intronic
1183472865 22:38018895-38018917 GAGCCATCCTGGCCCTCCAGAGG - Intronic
1183700792 22:39449881-39449903 CAGCACCCCTGGCCCTCATGGGG + Intergenic
1183964214 22:41431731-41431753 AGGCCATCCTGCCCCTGCTGTGG + Intergenic
1183965623 22:41440315-41440337 AGACCATCCTGGCCAACATGGGG - Intronic
1184089540 22:42284995-42285017 AAGCCATCCTTGGCCTGGTGGGG + Intronic
1184142948 22:42589609-42589631 AAACCAGCCTGGCCAACATGAGG + Intronic
1184298057 22:43538585-43538607 ATACCATCCTGGCCAACATGGGG - Intronic
1184624674 22:45715447-45715469 AAGCCATCCTGGGCTGCATGCGG - Intronic
1184957096 22:47896211-47896233 AGACCATCCTGGCCAACATGGGG - Intergenic
1185135148 22:49066209-49066231 AAGCCATCCTGGGCCACATGGGG + Intergenic
949283787 3:2377695-2377717 AAGCTATCCTTGGCCACATGCGG - Intronic
949541335 3:5034459-5034481 AAACCAGCCTGGCCAACATGGGG + Intergenic
949702773 3:6778405-6778427 AGACCAGCCTGGCCATCATGGGG + Intronic
949812681 3:8023159-8023181 AAGCCATCATAGGCCACATGTGG + Intergenic
949979559 3:9493325-9493347 AGGCCAGCCTGGCCAACATGGGG - Intergenic
950206124 3:11082563-11082585 AGGCCAGCCTGGCCAACATGGGG - Intergenic
950666685 3:14499950-14499972 AAGCTATCCTGGGCTACATGCGG + Intronic
951000595 3:17555047-17555069 AGACCATCCTGGCCAACATGGGG - Intronic
951041341 3:17991874-17991896 AAGCCGTCCTGGGCCACATGTGG - Intronic
951629250 3:24700308-24700330 AAGCCATCCTGGGCTGCATGTGG - Intergenic
951861283 3:27256067-27256089 AAGGTATCATGCCCCTCATGGGG - Intronic
952412946 3:33065609-33065631 AAGCCATCCTGGGCTGCATGTGG - Intronic
954102197 3:48382313-48382335 AGACCATCCTGGCCAACATGGGG - Intronic
954119594 3:48489124-48489146 AAGCCATCCTGGCCTGAATGTGG - Intronic
954174082 3:48829318-48829340 AGGCCAGCCTGGCCAACATGGGG + Intronic
954527059 3:51281355-51281377 AAGCCATCCTGGGCTGCATATGG + Intronic
955070782 3:55570925-55570947 AGACCATCCTGGCCAACATGGGG + Intronic
955141756 3:56276908-56276930 AAACCATCCTGGGCCACATGTGG + Intronic
955285448 3:57636736-57636758 AGACCATCCTGGCCAACATGGGG + Intronic
955338706 3:58108195-58108217 AAGCCATCCTGGGCCGCATGCGG + Intronic
955470259 3:59279286-59279308 AAACCATCCTGGCCAACATGGGG - Intergenic
955637005 3:61041178-61041200 ACCCCATCCTGGCCAACATGCGG + Intronic
955727843 3:61951917-61951939 AGACCATCCTGGCCAACATGGGG + Intronic
955759157 3:62259470-62259492 AAGCCATCCTGGGCCGCCTGTGG + Intronic
955790474 3:62583894-62583916 ACGCCCTCCTGGACTTCATGTGG + Intronic
955832551 3:63019492-63019514 AAGCTGTCCTGGGCCACATGTGG + Intergenic
955906421 3:63812359-63812381 AAGCCATCCTGGGTCACCTGTGG + Intergenic
956205132 3:66747698-66747720 TAACCCTCATGGCCCTCATGAGG + Intergenic
956217264 3:66861355-66861377 AAGCCATCTTGGCCTGCATGTGG + Intergenic
957423989 3:80011665-80011687 AGGCCAGCCTGGCCAACATGGGG + Intergenic
957970820 3:87379863-87379885 AAGCCATCATGGGCTGCATGTGG + Intergenic
958112313 3:89164335-89164357 AAGCCATCCTGGGCCGCATGCGG + Intronic
958594073 3:96199891-96199913 AAGCTATCCTGAACCACATGTGG + Intergenic
958599520 3:96277185-96277207 AAGCCATCCTGAGATTCATGTGG + Intergenic
958688992 3:97436964-97436986 AAGCCGTCCTGGGCCACGTGTGG - Intronic
958700971 3:97589064-97589086 AAGCCATCCTGGGCCACATGAGG - Intronic
958778579 3:98514367-98514389 AGGCCAGCCTGGCCGACATGGGG + Intronic
958810032 3:98850411-98850433 AAGCTGTCCTGGGCCGCATGTGG + Intronic
958918737 3:100078970-100078992 AAGCTGTCCTGGGCCACATGTGG + Intronic
959259916 3:104064555-104064577 AAGCCATCCTGGGCTGCATGCGG - Intergenic
959445471 3:106433903-106433925 AGACCATCCTGGCCAACATGGGG + Intergenic
959574737 3:107922461-107922483 AAGCCATCCTGGGCCACATGTGG + Intergenic
959913239 3:111788670-111788692 AAGCTGTCCTGGGCCTCATGAGG - Intronic
960661669 3:120067077-120067099 AAGCTGTCCTGGGCCACATGTGG + Intronic
961070662 3:123921815-123921837 AACCCATCCTGGGCTGCATGTGG + Intronic
961180934 3:124876814-124876836 AAGCCATCCAGGGCCAAATGTGG + Intronic
961183490 3:124894997-124895019 AAGCCATCCTGGGCCTCATGTGG + Intronic
961547666 3:127646584-127646606 AGACCATCCTGGCCAACATGGGG - Intronic
961846520 3:129769163-129769185 AAGCCATCCTGGGCCACGTGCGG - Intronic
962544204 3:136415636-136415658 AAGACAGCCTGGCCAACATGGGG + Intronic
962819254 3:139032097-139032119 AAGCCATCCTAGGCTGCATGCGG - Intronic
962899643 3:139748732-139748754 AATCCATCCTGGTCTGCATGTGG + Intergenic
963641883 3:147870980-147871002 AAGCCATCATGGGCATCAGGAGG - Intergenic
963843645 3:150132917-150132939 AAGCCATCCTGGGCCCCATGTGG - Intergenic
964348035 3:155774586-155774608 AAGCCATCCTGGGCTGCATGTGG - Intronic
964505323 3:157392689-157392711 AAGCTGTCCTGGGCCTCATGTGG + Intronic
964782073 3:160350614-160350636 AGACCATCCTGGCCAACATGGGG + Intronic
965355900 3:167672591-167672613 AAGCCATCTTGGGCTACATGTGG - Intergenic
965372271 3:167877912-167877934 AAACCAGCCTGGCCAACATGGGG + Intergenic
965573306 3:170192802-170192824 AGACCATCCTGGCCAACATGGGG - Intergenic
965588821 3:170343289-170343311 AGACCATCCTGGCCAACATGGGG - Intergenic
965723258 3:171685048-171685070 AAGCCATCCCGGGCCGCATGTGG - Intronic
965883707 3:173418902-173418924 AAGCCATCCTGGACCCCATGTGG - Intronic
967020669 3:185519635-185519657 AAACCAGCCTGGCCAACATGGGG + Intronic
967185420 3:186940514-186940536 AAGCCATCCTGGGCTACATGCGG - Intronic
967950197 3:194834661-194834683 AGACCATCCTGGCCAACATGGGG + Intergenic
968028674 3:195464456-195464478 AAGCCATCCTGGGCTGCGTGCGG - Intergenic
968166362 3:196468473-196468495 AAACCAGCCTGGCCAACATGGGG - Intergenic
968261379 3:197327456-197327478 AGACCATCCTGGCCATCAAGGGG + Intergenic
968268061 3:197377829-197377851 AATCCAGCCTGGCCAACATGGGG + Intergenic
968336356 3:197916961-197916983 AAGCCATCCTGGGCCGCATGTGG + Intronic
968340540 3:197951894-197951916 AATCCAGCCTGGCCAACATGGGG - Intronic
968644691 4:1734384-1734406 AGGCCAGCCTGGCCAACATGGGG - Intronic
968822083 4:2861860-2861882 AAGCTGTCCTGGGCCACATGTGG - Intronic
968841695 4:3011653-3011675 GAGCCCTGCTTGCCCTCATGCGG + Intronic
969351616 4:6601303-6601325 AGACCATCCTGGCCAACATGGGG + Intronic
970261730 4:14231697-14231719 AAGCCATCCTGTGCTGCATGTGG + Intergenic
970264793 4:14270022-14270044 ATGCCATGCAGGGCCTCATGGGG - Intergenic
970480880 4:16472617-16472639 AAGCCATCCTGGGCTGCATGTGG + Intergenic
971093598 4:23372972-23372994 AAACCAGCCTGGCCAACATGGGG + Intergenic
971209963 4:24606727-24606749 AAGCTGTCCTGGGCCTCATGTGG + Intergenic
971283206 4:25259776-25259798 AAGCCATCCTGGGCAGCATGCGG + Intronic
972402683 4:38719831-38719853 AAGCCATCCTGGGCTGCATTAGG - Intergenic
972501337 4:39680811-39680833 AAGCTGTCCTGGCCTGCATGTGG + Intergenic
972522966 4:39878940-39878962 AGACCATCCTGGCCAACATGGGG - Intronic
973077438 4:45947178-45947200 AGGCCAGCCTGGCCAACATGGGG + Intergenic
973827660 4:54724828-54724850 AAGCCGTCCTGGGCCACATGTGG + Intronic
973975936 4:56262432-56262454 AAGCCATTCTGGGCTGCATGTGG - Intronic
974481028 4:62442973-62442995 AGACCATCCTGGCCAACATGGGG + Intergenic
975116562 4:70687561-70687583 AAACCAGCCTGGCCAACATGGGG - Intergenic
975660630 4:76685447-76685469 AAGCTATCCTGGGCCACATGCGG + Intronic
975733496 4:77359636-77359658 CAGCCATCCTGTCCTTCCTGAGG + Intronic
976269221 4:83213946-83213968 AAGCCATCCTGGACTGCATGAGG - Intergenic
976291142 4:83419090-83419112 AAGCCATCCTGGGCCGCATGTGG - Intronic
976294072 4:83452171-83452193 AAGCCATTCTGGGCCTCATGAGG - Intronic
976724849 4:88205879-88205901 AGACCATCCTGGCCAACATGGGG - Intronic
976871448 4:89798753-89798775 AAACCATCCTGGGCCGCTTGTGG + Intronic
977369131 4:96112531-96112553 AGACCATCCTGGCCAACATGGGG - Intergenic
977415157 4:96723191-96723213 AAGCTGTCCTGGGCCACATGCGG + Intergenic
978298365 4:107235803-107235825 AGACCATCCTGGCCAACATGAGG + Intronic
978424226 4:108565591-108565613 AAGCCATCCTGGGCCACGTGTGG + Intergenic
978455538 4:108886368-108886390 AAGCCATCCTGGGCTGCATGTGG - Intronic
978830303 4:113076272-113076294 AATCCATCCTTGGCCGCATGTGG + Intronic
978941193 4:114437767-114437789 AAACCATCCTGGGCTGCATGTGG - Intergenic
979378040 4:119972191-119972213 AAGCCATCCTGGGCTGCACGTGG + Intergenic
979550317 4:121983677-121983699 AAGCCATCCTGGGCTGCATGTGG + Intergenic
980117415 4:128692576-128692598 AGACCATCCTGGCCAACATGGGG + Intergenic
980118112 4:128700458-128700480 AAGCCATCCTGGGCTAAATGTGG - Intergenic
980256854 4:130392804-130392826 AAGCCGTCCTGGGCCACATTGGG + Intergenic
980902427 4:138917686-138917708 AAGCCATCCTGGGCCTCATGTGG + Intergenic
981154419 4:141417186-141417208 AAGCCCTCCTGGGCCACATGCGG + Intergenic
981610183 4:146585350-146585372 AAGCTGTCCTGGGCCACATGTGG + Intergenic
981638825 4:146912177-146912199 AAGCCATCCTGGGCCGCATGTGG + Intronic
981828567 4:148973650-148973672 AAGCCATCCTGGGTCACAGGCGG - Intergenic
981881198 4:149614797-149614819 AAGCCATCCTGGGCCACATGTGG + Intergenic
982064518 4:151641459-151641481 AAGCTGTCCTGGGCCACATGCGG - Intronic
982160659 4:152565704-152565726 AAGCCATCCTGAGCCACATGCGG - Intergenic
982424983 4:155247594-155247616 AGGCCAGCCTGGCCAACATGGGG + Intergenic
982550861 4:156797698-156797720 AAGCCGTCCTGGGCCACATGGGG + Intronic
982607793 4:157536827-157536849 AAGCCACCCTGGGCCACATGTGG + Intergenic
982703072 4:158677401-158677423 AAGGCATCCTGGGCAACATGTGG + Intronic
983146632 4:164224098-164224120 AAGCTGTCCTGGGCCACATGTGG - Intronic
983366198 4:166793517-166793539 AAGCTGTCCTGGGCCACATGTGG + Intronic
983436158 4:167718496-167718518 AAGCCGTCCTGGGCCACATGTGG - Intergenic
983519780 4:168696099-168696121 AAGCTGTCCTGGGCCACATGTGG + Intronic
983722841 4:170878696-170878718 AAGCCGTCCTGGGCCACACGTGG - Intergenic
983833276 4:172358430-172358452 AAGCCAGCCTGGGCCGCACGCGG - Intronic
984158241 4:176220099-176220121 AAGCCATCCTGGGCCGCATGGGG + Intronic
984172858 4:176381526-176381548 AAGCCACCCTGGGCCTCATGTGG - Intergenic
984509422 4:180660526-180660548 AAGCCAACCTGGGCCACCTGTGG + Intergenic
984723057 4:182994396-182994418 AAGCCATCCTGGGCTGCATGAGG - Intergenic
985292346 4:188399592-188399614 AAGCCATCCTGGGCTGCATGTGG - Intergenic
985347435 4:189021438-189021460 AAGCTGTCCTGGGCCGCATGTGG - Intergenic
985424239 4:189812874-189812896 AAGCCATCCTAGGCCCCATGTGG + Intergenic
985559066 5:572935-572957 AAGCCATCCTGGGCCACATGTGG - Intergenic
986139121 5:5013094-5013116 AAGCTGTCCTGGGCCACATGCGG + Intergenic
986725176 5:10590517-10590539 AAGTCATCCTGGGCCTCATGTGG - Intronic
986899617 5:12415710-12415732 AAGCCATCCCGGCTGTCATATGG - Intergenic
987035685 5:14015957-14015979 AAACCAGCCTGGCCAACATGGGG + Intergenic
987262768 5:16220297-16220319 GAGGCATTCTGGACCTCATGAGG - Intergenic
987556361 5:19456251-19456273 AGACCAGCCTGGCCATCATGGGG + Intergenic
987667225 5:20959173-20959195 AGACCATCCTGGCCAACATGGGG - Intergenic
988224767 5:28398887-28398909 AGACCATCCTGGCCAACATGGGG + Intergenic
988464781 5:31478374-31478396 AAGCCGTCCTGGGCCATATGTGG + Intronic
988537706 5:32083873-32083895 AAACCAGCCTGGCCAACATGGGG - Intronic
988547357 5:32171354-32171376 AAGCCATCCTGGGCCACATTTGG + Intronic
988821429 5:34890035-34890057 AGACCATCCTGGCCAACATGGGG - Intronic
989988949 5:50738798-50738820 AAGCCATCCTGGACTGCATGTGG + Intronic
990318196 5:54603893-54603915 CAGCTATCCTTGCCCTCAAGTGG + Intergenic
990320795 5:54628123-54628145 AAGACATCCTGGGCCTCAAGTGG - Intergenic
990403596 5:55465615-55465637 AAGCCATCCTGGGCCACATGTGG + Intronic
991097905 5:62758764-62758786 AAGCCATCCTGGGCTGCATGTGG - Intergenic
991570023 5:68043975-68043997 GAGCCATCATGGGCCACATGTGG - Intergenic
992594532 5:78332282-78332304 AAACCAGCCTGGCCAACATGGGG + Intergenic
992632682 5:78697252-78697274 AGACCAGCCTGGCCATCATGGGG + Intronic
992834842 5:80630064-80630086 AAACCAGCCTGGCCAACATGGGG + Intronic
992916714 5:81462245-81462267 AAGCCGTCCTGGGCCACATTTGG + Intronic
993199538 5:84796532-84796554 AAGCCGTCCTGGTCTGCATGGGG - Intergenic
993548982 5:89250151-89250173 AAGCCATCCTGGGCCACATGTGG + Intergenic
993719803 5:91311220-91311242 AAGCCATCCTGGGCCACATGTGG + Intergenic
993729507 5:91405658-91405680 AGGCCATCCTGGGCTACATGTGG + Intergenic
994082533 5:95723263-95723285 AAGCCATCCTGGGCCACATGCGG + Intronic
994761335 5:103857956-103857978 AAGCCATTCTGGGCCACTTGCGG - Intergenic
994858969 5:105163177-105163199 AAGCCATCCTTGACCACATGTGG - Intergenic
995044467 5:107629700-107629722 AAGCCATCCTGGGCCACATGTGG - Intronic
995075092 5:107973271-107973293 AAGCCATCCTAGACTGCATGTGG - Intronic
996372500 5:122768226-122768248 AGGCCAGCCTGGCCAACATGGGG + Intergenic
996563428 5:124855187-124855209 AAGCCATCCTGGGCCACATGTGG + Intergenic
996650198 5:125866494-125866516 ATGCCATCCTGGGCCACATGTGG - Intergenic
996653308 5:125909150-125909172 AAGTTGTCCTGGCCCACATGAGG + Intergenic
996833393 5:127764810-127764832 ATGCCATCCTGGGCCACATGTGG + Intergenic
996863874 5:128095602-128095624 AAGCTGTCCTGGGCCACATGTGG - Intronic
997079847 5:130725356-130725378 AAGCCGTCCTGGGCCTCATGTGG - Intergenic
997214369 5:132098140-132098162 AAGCTGTCCTGGGCCGCATGTGG + Intergenic
997398437 5:133582761-133582783 AAGGCATCCTGGCATTCAAGTGG - Intronic
998003743 5:138643694-138643716 AAGCTGTCCTGGGCCACATGTGG - Intronic
998248734 5:140534190-140534212 AGACCATCCTGGCCAACATGGGG + Intronic
998400823 5:141848292-141848314 AAACCAGCCTGGCCAACATGGGG - Intergenic
998599538 5:143571025-143571047 AGGAGATCCTGGACCTCATGTGG - Intergenic
998843547 5:146281613-146281635 AAGCCATCCTGGGCCATATGTGG + Intronic
998949820 5:147382041-147382063 AAGCCATCCTGAGGCACATGTGG + Intronic
998989430 5:147799481-147799503 AGGCCATCCGGGCCAACATGGGG - Intergenic
999207542 5:149860566-149860588 AAGCCGTCCTGGGCTGCATGTGG - Exonic
999635386 5:153616544-153616566 AAGCCATCCTGGGCTGCATGTGG + Intronic
1000104697 5:158048255-158048277 AGGCCAGCCTGGCCAACATGGGG + Intergenic
1000212979 5:159126192-159126214 AAGCCATCCTGGGCTGTATGTGG + Intergenic
1000284300 5:159813499-159813521 AAGCCATCTTGGTCCACATGTGG - Intergenic
1000351426 5:160355726-160355748 AAGCCATCCTGGGGTGCATGCGG - Intronic
1000383305 5:160648248-160648270 AAGCCACCCTGGGCCACATGTGG - Intronic
1000594772 5:163202203-163202225 AAGTCATCCTGGGCCGCATGTGG - Intergenic
1001492276 5:172164338-172164360 AAGCCATCCTGCCCCTAAGGGGG + Intronic
1002318395 5:178360452-178360474 GAGCCAGGCTGGGCCTCATGTGG + Intronic
1002499126 5:179635781-179635803 AGACCATCCTGGCCGACATGGGG + Intergenic
1002502550 5:179656742-179656764 AGACCATCCTGGCCGACATGGGG - Intergenic
1002589331 5:180278499-180278521 AGACCATCCTGGCCAACATGGGG + Intronic
1002620178 5:180482665-180482687 AGACCATCCTGGCCAACATGGGG - Intergenic
1002690679 5:181047951-181047973 ATCCCATCCTGGCCCTCGTCGGG + Exonic
1002768010 6:259628-259650 AAGCCATCCTGGACTGCGTGTGG - Intergenic
1002820608 6:720964-720986 AAGCCATCCTGGGCCACAAGTGG - Intergenic
1003329103 6:5114815-5114837 AAGCCATCCTGGACTGCACGTGG + Intronic
1003685563 6:8298708-8298730 AAACCAGCCTGGCCAACATGGGG - Intergenic
1003823355 6:9925035-9925057 AGGCCAGCCTGGCCAACATGGGG + Intronic
1003943653 6:11053206-11053228 AAGCCATCCTGGGCTGCATGTGG + Intergenic
1004235995 6:13874790-13874812 AAGCTGTCCTGGGCCACATGAGG - Intergenic
1004375063 6:15083925-15083947 AAGCCATCCTGGGCCATATGTGG + Intergenic
1004380029 6:15124748-15124770 AAGCATTCCTGGGCCACATGCGG + Intergenic
1004652180 6:17620603-17620625 GAGCCATCCTGGGCTACATGTGG - Intronic
1004682012 6:17905043-17905065 AAGCCGTCCTGGGCCCCATGAGG - Intronic
1004710665 6:18167154-18167176 AGACCATCCTGGCCAACATGGGG + Intronic
1005123080 6:22412699-22412721 AAGCCGTCCTGGGCCACCTGAGG - Intergenic
1005389720 6:25320965-25320987 AAGCCATCCTGGACTGCATGTGG + Intronic
1005438203 6:25837391-25837413 CAGCCATTGTGGCCCTGATGGGG + Intronic
1005706610 6:28461053-28461075 AGACCATCCTGGCCAACATGGGG - Intergenic
1006019080 6:31106483-31106505 AGACCATCCTGGCCAACATGGGG + Intergenic
1006118600 6:31790177-31790199 AAGCCGTCCTGGGCCGCATGTGG + Intronic
1006552185 6:34833726-34833748 AGACCATCCTGGCCAACATGGGG + Intronic
1006701032 6:35973469-35973491 AAGCTGTCCTGGGCCACATGTGG - Intronic
1006851284 6:37100598-37100620 AGACCATCCTGGCCAACATGGGG + Intergenic
1007051264 6:38832763-38832785 AAGCTGTCCTGGGCTTCATGTGG + Intronic
1007411898 6:41668837-41668859 AGACCATCCTGGCCAACATGGGG - Intergenic
1007432058 6:41782268-41782290 AGACCATCCTGGCCAACATGGGG - Intronic
1007489311 6:42206019-42206041 AGACCATCCTGGCCAACATGGGG + Intergenic
1007679326 6:43623662-43623684 AAGACATCCTGGCCCAAAGGAGG - Intronic
1008023335 6:46605088-46605110 AAGCCATCCTGGGCCACATGTGG + Intronic
1008394413 6:50990321-50990343 AAACCATCCTGGGCCACATGTGG - Intergenic
1008667396 6:53729593-53729615 AAGCCGTCCTGGTCTGCATGTGG + Intergenic
1008680430 6:53866157-53866179 AAACCATCCTGGGCCACTTGGGG + Intronic
1008746129 6:54671615-54671637 AAACCAGCCTGGCCAACATGGGG + Intergenic
1008872684 6:56290698-56290720 AGACCATCCTGGCCAACATGGGG - Intronic
1008895415 6:56548259-56548281 AAGCCATCCTGGGCCACAGGTGG + Intronic
1008942110 6:57057991-57058013 AGGCCAGCCTGGGCATCATGGGG - Intergenic
1009269137 6:61596848-61596870 AGACCATCCTGGCCAACATGGGG - Intergenic
1009349345 6:62654113-62654135 AATCCCCCATGGCCCTCATGTGG - Intergenic
1009646874 6:66415367-66415389 AAGCCATCCTGGGCCACATGTGG - Intergenic
1009910286 6:69917895-69917917 AAGCCATCCTGAGCTGCATGTGG + Intronic
1010111282 6:72236847-72236869 AAGTCATCCTGGGCCACTTGTGG + Intronic
1010365893 6:75050660-75050682 AAGCCCTCCTGCCCCTCACAGGG + Intergenic
1010439799 6:75880552-75880574 AAGCTGTCCTGGGCCACATGTGG + Intronic
1010583329 6:77626689-77626711 AAGCCATCCTGGGCTGCATGTGG - Intergenic
1011335793 6:86258322-86258344 AAGCTGTCCTGGGCCACATGTGG + Intergenic
1011412488 6:87080441-87080463 AAGCTATCCTATCCCTCAGGAGG - Intergenic
1011415149 6:87111081-87111103 AAACCATCCTGTCCAACATGGGG - Intergenic
1012306124 6:97660029-97660051 AAGCTATGCTGGGCCGCATGTGG + Intergenic
1012937921 6:105387726-105387748 AAGCCATCCTGGGCCACATGTGG + Intronic
1013010859 6:106118564-106118586 AAGCCATCCTGGGCTGCATGTGG + Intergenic
1013481434 6:110556291-110556313 AAGCCATCTTAGGCCACATGTGG + Intergenic
1013585543 6:111575386-111575408 AGACCATCCTGGCCAACATGGGG + Intronic
1013841298 6:114397485-114397507 AAGCCATCCTGGGCCTCATGTGG - Intergenic
1014006735 6:116427988-116428010 AGGCCAGCCTGGCCAACATGGGG + Intronic
1014085590 6:117339130-117339152 AAGTCGTCCTGGGCCACATGTGG - Intronic
1014101894 6:117520295-117520317 AGGCCATCCTGGGCTGCATGTGG + Intronic
1014739953 6:125137646-125137668 AAGCCTTCCTGGGCAGCATGCGG + Intronic
1014927036 6:127284804-127284826 AAGCCATCCTGGGCCACATGTGG - Intronic
1015013767 6:128384504-128384526 AAGCTATCCTAGGCCACATGTGG + Intronic
1015014022 6:128388020-128388042 AAGCTATCCTGGGCAGCATGTGG + Intronic
1015235479 6:130966102-130966124 AAGCTTTCCTGGGCCTCCTGCGG + Intronic
1015715847 6:136191466-136191488 AGGCCAACCTGGCCAACATGGGG + Intronic
1015740000 6:136443646-136443668 AAACCAGCCTGGCCAACATGGGG - Intronic
1016085741 6:139911999-139912021 AAGCCATCCTGGGATGCATGTGG + Intergenic
1016358748 6:143246084-143246106 AAGCCATCCTGGGCTGCAGGTGG + Intronic
1016509896 6:144830622-144830644 AAGCTGTCCTGGGCCACATGTGG - Intronic
1016776878 6:147914074-147914096 AAGCCATCCTGGGCCGTATGCGG - Intergenic
1017109067 6:150915176-150915198 AAGCTATCCTGGGCTACATGCGG - Intronic
1017508268 6:155088724-155088746 AAGCCATCCTGGGCCGCAGGTGG - Intronic
1018406281 6:163486000-163486022 AAGCCTTCCTGGGCCGCATGCGG + Intronic
1018503859 6:164442955-164442977 AAGCCATCCTGGGCCACATGTGG - Intergenic
1019522889 7:1468558-1468580 GAGGCAGCCTGGCCCTCAGGAGG + Intergenic
1020801405 7:12737222-12737244 AGACCATCCTGGCCAACATGGGG - Intergenic
1021139531 7:17006933-17006955 AAGCCATCCTGAGCCACATGTGG - Intergenic
1021292450 7:18863343-18863365 AAGCCGTCCTGGGCCCCATGTGG - Intronic
1021499250 7:21311548-21311570 AAGCCATCCTGGGCCGCATGTGG + Intergenic
1021854840 7:24844294-24844316 AAGCCATCCTGGGCCATATGTGG - Intronic
1022118754 7:27286380-27286402 AAGCCGTCCCGACCCACATGTGG - Intergenic
1022487637 7:30791951-30791973 AAGCCATCCTGGGCTGCATGTGG + Intronic
1023078954 7:36509872-36509894 AAACCAGCCTGGCCAACATGGGG - Intergenic
1023178085 7:37453041-37453063 AAGTCGTCCTGGGCCACATGCGG - Intergenic
1023204855 7:37737501-37737523 AAGCCATCCTGGACTGTATGTGG - Intronic
1023311943 7:38896469-38896491 AAGCCATCCTAGGCCATATGTGG - Intronic
1023373497 7:39534272-39534294 AAGCCATTCTGGGCCGCCTGCGG + Intergenic
1023721147 7:43096103-43096125 AAGCCATCCTGGGCTGCATGGGG + Intergenic
1023919918 7:44620672-44620694 AAGCTGTCCTGGGCCACATGTGG - Intronic
1024395001 7:48856024-48856046 AAGCTGTCCTGGCCCACATGCGG - Intergenic
1024400267 7:48916651-48916673 AAGCTGTCCTGGCCCACATGTGG + Intergenic
1024726090 7:52196986-52197008 AAGCCATCCTGGGCTGCATGTGG - Intergenic
1025127394 7:56354946-56354968 AAACCAGCCTGGCCAACATGGGG + Intergenic
1025230473 7:57200778-57200800 GAGCCACCCTGGCCCTGCTGAGG + Intergenic
1026313813 7:69211071-69211093 AAACCAGCCTGGCCAACATGGGG + Intergenic
1026512721 7:71040374-71040396 AAGCCAGCCTATTCCTCATGTGG - Intergenic
1026599146 7:71759970-71759992 AAGCCAGCCTGGCCAACATGGGG - Intergenic
1026760688 7:73123654-73123676 AAACCAGCCTGGCCAACATGGGG - Intergenic
1026937358 7:74265698-74265720 AGACCATCCTGGCCAACATGGGG - Intergenic
1027037032 7:74932475-74932497 AAACCAGCCTGGCCAACATGGGG - Intergenic
1027086531 7:75268984-75269006 AAACCAGCCTGGCCAACATGGGG + Intergenic
1027128877 7:75576521-75576543 AGGCCAGCCTGGCCAACATGGGG + Intronic
1027409852 7:77904918-77904940 AAGCCATCCTGGGCTGCATGTGG - Intronic
1027514299 7:79122888-79122910 AAACCAGCCTGGCCAACATGGGG - Intronic
1027624298 7:80528363-80528385 AAGTCAACCTGGCCCTGAAGTGG - Intronic
1028136469 7:87228192-87228214 AAGCCATCTTGGACTGCATGTGG + Intergenic
1028156379 7:87434547-87434569 AGACCATCCTGGCCAACATGGGG + Intronic
1028254596 7:88578375-88578397 AAGCTCTCCTGGGCCTCATGAGG + Intergenic
1028557361 7:92138198-92138220 AAACCAGCCTGGCCAACATGGGG + Intronic
1028802299 7:94980260-94980282 AAGCCACCCTGGGCCTCATGCGG + Intronic
1028961326 7:96752513-96752535 AAGCCATCCCGGTCTGCATGTGG + Intergenic
1029311359 7:99668404-99668426 AAGCCATCCTGGACTGCATGAGG - Intronic
1030017177 7:105234929-105234951 AAGCCGTCCTGGGCTGCATGTGG - Intronic
1030199395 7:106887062-106887084 AAGCCATCCTGGGCTACATTCGG + Intronic
1030307993 7:108038578-108038600 AAGCCGTCCTGGGCCACATGTGG - Intronic
1030577626 7:111310034-111310056 AGACCATCCTGGCCAACATGGGG + Intronic
1030610837 7:111687227-111687249 AGACCATCCTGGCCAACATGGGG - Intergenic
1030687400 7:112501404-112501426 AGACCATCCTGGCCAACATGGGG - Intergenic
1031316399 7:120262763-120262785 AAACCATCCTGGCCGACATAGGG - Intergenic
1031477169 7:122237349-122237371 AAGCCATCCTGGACCATATGTGG + Intergenic
1031561839 7:123248434-123248456 ATGTTATCCTGGCCCTCAGGTGG + Intergenic
1031614715 7:123866987-123867009 AGACCATCCTGGCCAACATGGGG - Intronic
1032301167 7:130688693-130688715 AAGCCATCCTGGGCCACGTGTGG + Intergenic
1032744694 7:134773968-134773990 AAACCAGCCTGGCCAACATGGGG + Intronic
1032747830 7:134805957-134805979 AGGCCAGCCTGGCCAACATGGGG - Intronic
1032761749 7:134949982-134950004 AAGCCATCCTGGGCATGATGTGG + Intronic
1032820102 7:135516460-135516482 AAGCTATCCTGGACCCCATGTGG - Intergenic
1033205214 7:139414436-139414458 AAGCCATCCTGGGCAGCATGCGG + Intronic
1033929197 7:146503310-146503332 AAGCCATCCTGAGCTGCATGTGG - Intronic
1034125328 7:148666452-148666474 AAGCCGTCGTGGGCCCCATGTGG - Intergenic
1034638000 7:152582524-152582546 AGACCATCCTGGCCAACATGGGG + Intergenic
1034658317 7:152747113-152747135 AAGCCATCCTGGGCTGCATTTGG - Intergenic
1035748261 8:1977012-1977034 AAGCTGTCCTGGGCCACATGTGG - Intronic
1035842560 8:2828221-2828243 AAGCCACCCTGGGCAGCATGTGG + Intergenic
1036413122 8:8520800-8520822 AAACCATCCTGGGGCACATGTGG + Intergenic
1036475932 8:9093311-9093333 AAGCCGTCCTGGGCTGCATGTGG + Intronic
1036585074 8:10116188-10116210 ACGGCATCCTGGGCCACATGTGG - Intronic
1037245451 8:16829698-16829720 AAACCAGCCTGGCCAACATGGGG - Intergenic
1037309132 8:17536364-17536386 AAACCAGCCTGGCCAACATGGGG + Intronic
1038571749 8:28668533-28668555 AGACCATCCTGGCCAACATGGGG - Intronic
1039197584 8:35049433-35049455 AAACCAGCCTGGCCAACATGGGG + Intergenic
1039318345 8:36398512-36398534 AAGCTGTCCTGGGCCACATGTGG + Intergenic
1039647872 8:39306788-39306810 AAGCCATCCTTGCTCTAAAGTGG - Intergenic
1039649057 8:39320884-39320906 AAGCCATCCTGGGCCATATGTGG + Intergenic
1039804107 8:40984098-40984120 AAACCATCCTGGCTAACATGGGG + Intergenic
1039830007 8:41205764-41205786 AAGCCATCCTGGGCCACATGTGG + Intergenic
1039856601 8:41420635-41420657 AGACCATCCTGGCCAACATGAGG - Intergenic
1039944085 8:42115333-42115355 AAGCCATCCTGGGCCGAATGTGG + Intergenic
1040385215 8:46910685-46910707 AAGCCATCCTGGGCTGCATGTGG + Intergenic
1040957644 8:52995865-52995887 AGACCATCCTGGCCAACATGGGG - Intergenic
1041003823 8:53480288-53480310 AGACCATCCTGGCCAACATGGGG - Intergenic
1041023631 8:53661616-53661638 AAGCCATCCTGGGCCACAAGTGG - Intergenic
1041268243 8:56085466-56085488 AGACCATCCTGGCCAACATGGGG - Intergenic
1041531652 8:58874964-58874986 AAGCTGTCCTGGGCCACATGTGG + Intronic
1041644727 8:60239562-60239584 AAGCCATCCTGGGCTGCATGTGG + Intronic
1041676018 8:60540678-60540700 AGGCCAGCCTGGCCAACATGGGG - Intronic
1042008129 8:64205822-64205844 AAGCCATCCTGAGCTGCATGTGG + Intergenic
1042211165 8:66381833-66381855 AAGCCGTCCTGGGCCGCTTGTGG - Intergenic
1042366334 8:67940931-67940953 AAGCCATCCTGGGCTGCATGTGG - Intergenic
1042729039 8:71910879-71910901 AAGCCATCCTGGGCTGCATATGG - Intronic
1042934259 8:74042973-74042995 AGACCATCCTGGCCAACATGGGG - Intergenic
1043160333 8:76838854-76838876 AAACCAGCCTGGCCAACATGAGG + Intronic
1043499680 8:80840235-80840257 AAGCCATCCTGGACCTCATGCGG - Intronic
1043576178 8:81660197-81660219 AAGCCATCCTGAGCCACATGTGG + Intronic
1044024549 8:87152517-87152539 AAGTCATCCTGGGCTGCATGTGG + Intronic
1044242776 8:89906359-89906381 AAGCCATCCTGGGCCGCATGTGG + Intronic
1044346329 8:91108648-91108670 AAGCCGTCCTGGGCCGCATGTGG - Intronic
1044461398 8:92448829-92448851 AAGCCTTCCTGGGCCGCATGTGG + Intergenic
1044532195 8:93319903-93319925 AAGCCATCCTGAGTCACATGTGG + Intergenic
1044558854 8:93592918-93592940 AAGCCATCCTGAGTCACATGGGG + Intergenic
1044894617 8:96878164-96878186 AGACCATCCTGGCCAACATGGGG - Intronic
1045050230 8:98317934-98317956 AAGCCATCCTGGGCTGCATGTGG + Intergenic
1045367031 8:101485731-101485753 AAGCCATCCTGGGCCACATGTGG - Intergenic
1045596496 8:103662165-103662187 AGGCTGTCCTGGGCCTCATGTGG + Intronic
1045733241 8:105266169-105266191 AAGCCATCCTGAGCCACATGTGG - Intronic
1046094955 8:109546553-109546575 AAGCCATCCTGGGCTATATGAGG - Intronic
1046714851 8:117556400-117556422 AAGCCAGCCTGGCCAACATGGGG - Intergenic
1046773303 8:118137836-118137858 AAGCCATCCAGGGCCACATACGG + Intergenic
1046833962 8:118778918-118778940 AAGCTGTCCTGGACCACATGTGG + Intergenic
1047140513 8:122133795-122133817 AGACCATCCTGGCCAACATGGGG - Intergenic
1047408405 8:124604295-124604317 AAACCATCCTGGGGCGCATGGGG + Intronic
1047463332 8:125089466-125089488 AAGCCATTCTGGGCCGCATGTGG + Intronic
1047628392 8:126679563-126679585 AAGCCATCCTGGGCCACATGTGG - Intergenic
1047812206 8:128423147-128423169 AGACCATCCTGGCCAACATGGGG + Intergenic
1048048728 8:130797151-130797173 AAGACGTCCTGGGCCACATGTGG - Intronic
1048562402 8:135555296-135555318 AAGCCTTCCTGGGCCACATGTGG - Intronic
1049147390 8:141011077-141011099 GAGCCATGCTGGTTCTCATGCGG - Intergenic
1049985505 9:947181-947203 AAGTCATTCTGGGCCGCATGTGG - Intronic
1050006689 9:1139590-1139612 AGACCATCCTGGCCAACATGGGG - Intergenic
1050044060 9:1525326-1525348 AAACCATCCTGGGCCGCATGTGG + Intergenic
1050456071 9:5835681-5835703 AAGGCCTCCTGGCCCTGGTGAGG + Intergenic
1050928862 9:11299921-11299943 AAGCTCTCCTGGGCCACATGTGG + Intergenic
1051123818 9:13780982-13781004 AAGCAGTCCTGGGCCTCATGTGG - Intergenic
1051410080 9:16780371-16780393 AGACCATCCTGGCCAACATGGGG + Intronic
1051446245 9:17142172-17142194 AAGCCATCCTGGGCTGCATGCGG - Intronic
1051657873 9:19400033-19400055 AGACCAGCCTGGCCCACATGGGG + Intergenic
1051763679 9:20498552-20498574 AAGCCATCTTGGGCTGCATGTGG - Intronic
1052035062 9:23671131-23671153 AAGCCATCCTGGGCTGCAAGCGG + Intergenic
1052142150 9:25000404-25000426 AAGCAATTCGAGCCCTCATGAGG - Intergenic
1053463133 9:38286169-38286191 AAGCCACCCTGGGCTGCATGTGG + Intergenic
1053536770 9:38934157-38934179 AGGCCAGCCTGGCCAACATGGGG + Intergenic
1053661691 9:40287615-40287637 AGACCATCCTGGCCAACATGGGG - Intronic
1053912063 9:42916966-42916988 AGACCATCCTGGCCAACATGGGG - Intergenic
1054373815 9:64433851-64433873 AGACCATCCTGGCCAACATGGGG - Intergenic
1054522917 9:66088669-66088691 AGACCATCCTGGCCAACATGGGG + Intergenic
1054629366 9:67429773-67429795 AGGCCAGCCTGGCCAACATGGGG - Intergenic
1054720148 9:68595897-68595919 AAGCCATCCTGGGTCACATGTGG + Intergenic
1054760213 9:68998253-68998275 AGGCCAGCCTGGCCAACATGGGG - Intronic
1054861368 9:69957133-69957155 AAGCTATCCTGGGCCACATGAGG - Intergenic
1055027694 9:71739695-71739717 AAGCTGTCCTGGGCCACATGTGG - Intronic
1055152897 9:73024528-73024550 AAACCAGCCTGGCCAACATGTGG + Intronic
1055587745 9:77772994-77773016 AAGCCGTCCTGGGCCACGTGAGG + Intronic
1055645671 9:78359199-78359221 AAGCTATCTTGGACCACATGTGG + Intergenic
1055664137 9:78536298-78536320 AAGCTGTCCTGGGCCACATGAGG + Intergenic
1055677902 9:78684048-78684070 AAGCCATCCTGGGCTGCATGTGG + Intergenic
1055761613 9:79614719-79614741 AAGCTATCCTGGGCCACATGTGG - Intronic
1055830665 9:80374784-80374806 AAATCATCCTGGGCCACATGTGG - Intergenic
1055842718 9:80525236-80525258 AATCCATCCTAGCACTGATGTGG + Intergenic
1056649240 9:88443815-88443837 AAGCCATCCTGTCCCACAAGGGG - Intronic
1056830825 9:89915970-89915992 AAGCTATCCTGGGCCACATTTGG + Intergenic
1056925954 9:90834671-90834693 TAGCTATCCTGGACCACATGTGG - Intronic
1057426506 9:94954529-94954551 AAGTCATCTTGGGCCACATGTGG + Intronic
1057515588 9:95717720-95717742 AAGATATCCTGGGCCACATGTGG + Intergenic
1057741192 9:97712736-97712758 AAGCTATCCTGGGCCATATGTGG - Intergenic
1058023206 9:100112744-100112766 AAGCCTTCCTGGGCTACATGTGG + Intronic
1058200934 9:102039537-102039559 AAGCCATCCAGGGCTGCATGAGG + Intergenic
1058727002 9:107813963-107813985 AAGCCATCTTGGGCTGCATGCGG + Intergenic
1058782816 9:108355446-108355468 AGGCCAGCCTGGCCAACATGGGG + Intergenic
1058797592 9:108513430-108513452 AAGCCATCCTGGGCCACATGTGG - Intergenic
1059069844 9:111123938-111123960 AATCCAGCCTGGCCAACATGGGG + Intergenic
1059189231 9:112307870-112307892 AAGCCATCCTGTGCCGCATGTGG - Intronic
1059391158 9:114000406-114000428 AAGCCATCCTGGTCCACATGCGG - Intronic
1059606087 9:115837988-115838010 AAGCCATGCTGGGCTGCATGAGG - Intergenic
1059703035 9:116794452-116794474 AAGCCATCCTGAGCCACATATGG + Intronic
1059851792 9:118349673-118349695 AGGCCAGCCTGGCCCACATAGGG + Intergenic
1060209348 9:121700300-121700322 AAGCCATCCTGTCCTCCAGGGGG + Intronic
1060638622 9:125220198-125220220 AAACCAGCCTGGCCAACATGGGG - Intronic
1060692719 9:125678440-125678462 AGGCCATCCTGGCTAACATGGGG - Intronic
1060827645 9:126695852-126695874 AAGCCATCATGCCCTCCATGCGG - Exonic
1061339976 9:129972330-129972352 AAACCAGCCTGGCCAACATGGGG - Intronic
1061568263 9:131458861-131458883 GGGCCATCCTGGGCCACATGTGG + Intronic
1061843436 9:133373717-133373739 AAACCAGCCTGGCCAACATGGGG + Intronic
1061909009 9:133713001-133713023 CAGCCCTCCTGGCCCCCAAGAGG - Intronic
1062213341 9:135376330-135376352 AAGCACTCCTGGGCCTCAGGTGG - Intergenic
1062229057 9:135471070-135471092 AAACCAGCCTGGCCAACATGGGG + Intergenic
1062268727 9:135699301-135699323 CACCCATCCTGGGCCTCCTGGGG - Intronic
1062737940 9:138148803-138148825 AGACCAGCCTGGCCCACATGAGG - Intergenic
1203437386 Un_GL000195v1:152650-152672 AGACCATCCTGGCCAACATGGGG - Intergenic
1185471349 X:385880-385902 AGACCAGCCTGGCCCACATGGGG + Intronic
1185509736 X:654884-654906 AAACCAGCCTGGCCAACATGGGG - Intronic
1186344187 X:8674665-8674687 AAGCCGTCCTGGGCCTCATGCGG + Intronic
1187095058 X:16139382-16139404 AAGCCATCCCGGGCCGCAGGTGG - Intronic
1187458804 X:19466917-19466939 AAGCCATCCTGGGCCATATGTGG - Intronic
1188585492 X:31769670-31769692 AAGCCATCCTGGGACGCATGTGG + Intronic
1188767676 X:34116224-34116246 AGACCATCCTGGCCAACATGGGG - Intergenic
1188832122 X:34911707-34911729 AGACCATCCTGGCCAACATGGGG + Intergenic
1188918962 X:35948169-35948191 AAGCCGTCCTGGGCTGCATGTGG + Intronic
1188948715 X:36341233-36341255 AGACCATCCTGGCCAACATGGGG - Intronic
1188979255 X:36712494-36712516 AAACCGTCCTGGGCCGCATGTGG + Intergenic
1189156768 X:38765727-38765749 AAGCCATCCTGGGCCGCATGTGG + Intergenic
1189156879 X:38766948-38766970 AAGCCATCCTGGGCCATATGTGG - Intergenic
1189775758 X:44469173-44469195 AAGCCATCCTGGGGTGCATGCGG - Intergenic
1189983448 X:46532928-46532950 AAGCCATCCTGGGCCGCATGTGG + Intronic
1190069405 X:47267017-47267039 AAGCCGTCCTGGGCCACATGTGG - Intergenic
1190100530 X:47519342-47519364 AAACCAGCCTGGCCAACATGAGG - Intergenic
1190120553 X:47655872-47655894 AAGCCGTCCTGGACCGCATGTGG - Intronic
1190149602 X:47933178-47933200 AAGCCATCCTGGGCTGCATGTGG + Intronic
1190179705 X:48181872-48181894 AAACCAGCCTGGCCAGCATGGGG - Intergenic
1190251652 X:48731440-48731462 AAGCCGTCCTGGGCTGCATGTGG - Intergenic
1190299286 X:49047140-49047162 AAACCAGCCTGGCCAACATGGGG - Intergenic
1190366916 X:49703866-49703888 AAGCCATCCTGGGCCGCATGTGG + Intergenic
1192314265 X:70039839-70039861 AAGCCATCCTGGCCCACATGTGG + Intergenic
1192540726 X:71969509-71969531 AAACCAGCCTGGCCAACATGGGG - Intergenic
1193121210 X:77824499-77824521 AAGCCATCCTGGGTTGCATGCGG + Intergenic
1193223885 X:78958969-78958991 AAGCCATTCTGCTACTCATGAGG + Intronic
1193418375 X:81252689-81252711 AAGCCGTCCTGGGCCACATGTGG + Intronic
1193815187 X:86096529-86096551 AAGCCATCCCGGGCCGCATGCGG + Intergenic
1194113514 X:89868306-89868328 AGACCATCCTGGCCCACATGGGG + Intergenic
1194136301 X:90147881-90147903 AAGCCGTCCTGGTCTGCATGCGG + Intergenic
1194689147 X:96960919-96960941 AAACAATCCTGGCATTCATGGGG + Intronic
1195065359 X:101234375-101234397 GGGCCATCCTGGCCCTGGTGTGG + Intronic
1195222494 X:102759442-102759464 AAGCCATCCTGGGCCACATGAGG + Intergenic
1195544802 X:106102193-106102215 AAAACATCCTGGGCCGCATGTGG - Intergenic
1195777936 X:108428240-108428262 AAGCCGTCCTGGGCCATATGCGG + Intronic
1196100464 X:111842334-111842356 AGGCCAGCCTGGCCAACATGAGG - Intronic
1196158228 X:112454298-112454320 AAGCCATCCTGGGCTGCATGTGG + Intergenic
1196272082 X:113723986-113724008 AAGCTGTCCTGGACCACATGAGG - Intergenic
1196753417 X:119137606-119137628 AAGCCATCCTGGGCCGCATGCGG - Intronic
1196783787 X:119404894-119404916 AAGCCATCCCGGGCCACATGCGG + Intronic
1197128956 X:122981539-122981561 AAGCTCTCCTGGGCCACATGTGG - Intergenic
1197179597 X:123520186-123520208 AAGCCATCCTGGGACATATGTGG + Intergenic
1198230802 X:134687311-134687333 AAGCCATCCTGGGCCACATGTGG - Intronic
1198435738 X:136615325-136615347 AAGCTGTCCTGGGCCACATGCGG - Intergenic
1198646774 X:138816681-138816703 AAGCTGTCCTGGGCCTCATGCGG - Intronic
1198672594 X:139097381-139097403 AAGCCATCCTGGGCCACATGTGG + Intronic
1198688000 X:139248346-139248368 AAGCCATCCTGGGCCGCATGTGG - Intergenic
1200002628 X:153069903-153069925 AAGCAGTCTTGGCCCTCAAGGGG + Intergenic
1200005095 X:153080106-153080128 AAGCAGTCTTGGCCCTCAAGGGG - Intergenic
1200466198 Y:3523365-3523387 AGACCATCCTGGCCCACATGGGG + Intergenic
1200482057 Y:3717939-3717961 AAGCCGTCCTGGTCCGCATGCGG + Intergenic
1202097303 Y:21265045-21265067 AAACCATCCTGGCGGACATGGGG + Intergenic
1202582225 Y:26393864-26393886 AAGCTGTCCTGGGCCTCATGTGG + Intergenic