ID: 1132418002

View in Genome Browser
Species Human (GRCh38)
Location 15:101638143-101638165
Sequence CAAACAGGAGGGACTCTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132418002_1132418007 -1 Left 1132418002 15:101638143-101638165 CCCATCAGAGTCCCTCCTGTTTG 0: 1
1: 0
2: 1
3: 18
4: 150
Right 1132418007 15:101638165-101638187 GTTCACGAGCCCTCTCTCACTGG 0: 1
1: 0
2: 0
3: 4
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132418002 Original CRISPR CAAACAGGAGGGACTCTGAT GGG (reversed) Intronic
900142666 1:1145130-1145152 CAGCCAGGAGGGACTGTGGTTGG - Intergenic
902406902 1:16189331-16189353 GTAGCAGGAGGGACTCTGGTGGG - Intergenic
907868608 1:58422898-58422920 CTAACAGGAGCAAATCTGATTGG + Intronic
910582961 1:88848412-88848434 CAAAGAGGAGGAACTCTGAGAGG - Intergenic
911637368 1:100249848-100249870 CAAACTGGAGAGACTCTCCTCGG + Intergenic
913253059 1:116928303-116928325 CAGATAGGAGGGAATCTGAAAGG - Intronic
915314344 1:155019530-155019552 TGAACAGGAGGGACTCAGAGAGG - Intronic
917562887 1:176178529-176178551 CATAAAGGAGAGACTCTGAAAGG + Intronic
924156273 1:241179854-241179876 CACACATGAGGCACTTTGATAGG + Intronic
924452427 1:244190408-244190430 CAAAAGAGAGGGAATCTGATTGG + Intergenic
1069895943 10:71680120-71680142 CAAAGAGGCTGGACTCTGGTGGG - Intronic
1070097567 10:73352619-73352641 CAAACATAAGAGACTCTGAAAGG - Intronic
1071712546 10:88063799-88063821 CTCAGAGGAGGGACTCTGGTTGG + Intergenic
1071833245 10:89393032-89393054 CAGACAGAAGTGAATCTGATGGG - Intronic
1074758339 10:116644766-116644788 AAAACTGAGGGGACTCTGATGGG - Intronic
1074848878 10:117422611-117422633 CAAACAGCAGTGATACTGATGGG + Intergenic
1075177302 10:120177358-120177380 CAAACAGGAGGGGCACTCAGGGG - Intergenic
1075354434 10:121757856-121757878 CAAATATGAGGGAATATGATGGG - Intronic
1075764727 10:124884354-124884376 CAGACAGGAGGGAAACTGAAGGG + Intergenic
1076188810 10:128468838-128468860 CAAACACGATGGACTATTATTGG + Intergenic
1079991004 11:27246990-27247012 CAAAAAGCAGGGATTCTGTTGGG + Intergenic
1084152268 11:67294310-67294332 CAGTCAGGTGGGATTCTGATAGG + Intronic
1084475749 11:69387750-69387772 CCAACAAGAGGGACTTTGACAGG - Intergenic
1085237475 11:75026164-75026186 CATAACGGAGGGAATCTGATTGG + Intergenic
1088224457 11:107604222-107604244 TACACTGGAGGGACTGTGATAGG + Intronic
1091825772 12:3511612-3511634 CCAACAGGAGAGACTGTGAGGGG + Intronic
1093533006 12:20189260-20189282 CAAACATGGGACACTCTGATTGG - Intergenic
1093941231 12:25056975-25056997 AACACAGGAGGGAGTATGATTGG - Intronic
1096331653 12:50718434-50718456 AAAACAGGAGGGACAGGGATTGG - Intronic
1097633779 12:62096985-62097007 TAAACAGGAGACATTCTGATGGG - Intronic
1100302266 12:93318768-93318790 CAAACATAATGGGCTCTGATTGG - Intergenic
1102228415 12:111245763-111245785 CAAACAGGAGGCACTTGGGTGGG - Intronic
1103338885 12:120210698-120210720 CAAAAAGGAGGGACCCTCTTCGG + Exonic
1109305663 13:60637968-60637990 CATGGAGGAGGGACTCTGAGAGG + Intergenic
1116755747 14:48945943-48945965 CACAGAGGGGGAACTCTGATGGG + Intergenic
1117895959 14:60486281-60486303 AAAACAGGAGAGTCTCTGACAGG - Intronic
1122269942 14:100564448-100564470 CAGGCAGGAGGGACCCTGTTTGG + Intronic
1128730518 15:70017714-70017736 CAAGCTGGAGGGAGACTGATGGG + Intergenic
1129003230 15:72351261-72351283 GAAACCGGAGAGACTGTGATGGG - Intronic
1129165004 15:73771847-73771869 TGAGCAGGAGGGGCTCTGATAGG + Intergenic
1130784427 15:87080410-87080432 CAAAAAGAAGGGACTGGGATTGG + Intergenic
1131000693 15:88937589-88937611 CCAACAGAAGGGACTCTGAGTGG + Intergenic
1132250905 15:100334873-100334895 CACACGAGAGGGACTCTGAAGGG - Intronic
1132307177 15:100824996-100825018 CAAAAATGAGGGACTGGGATGGG - Intergenic
1132418002 15:101638143-101638165 CAAACAGGAGGGACTCTGATGGG - Intronic
1133141420 16:3747492-3747514 CAGACAGAAGGGACCCTGCTTGG - Intronic
1133809820 16:9152801-9152823 CAGGCAGGAAGGACTCTGCTGGG - Intergenic
1137329414 16:47476350-47476372 CAAACAAGAGGATCTCTGAATGG - Intronic
1139180598 16:64743606-64743628 CCAAATGGAGGTACTCTGATTGG - Intergenic
1139561260 16:67743849-67743871 CAGACAGGTGGGAGTCAGATAGG - Intronic
1140648518 16:77061861-77061883 CAAACAGGAGTGAATCTGATGGG + Intergenic
1144255406 17:13462665-13462687 CAAAGAGGAGGGCCTGAGATGGG + Intergenic
1149586289 17:57789748-57789770 CAAACAGGAGGGATATTGAGTGG + Intergenic
1150455929 17:65306632-65306654 CAAACAGCATGGACATTGATGGG + Intergenic
1151091479 17:71444841-71444863 AAGAAAGGAGGGGCTCTGATTGG + Intergenic
1151158476 17:72144378-72144400 GAGACAGGAGGAACTCTGAAAGG + Intergenic
1151436014 17:74097983-74098005 CTCAAAGGAAGGACTCTGATTGG + Intergenic
1152078083 17:78170746-78170768 CACACAGCGGGGACCCTGATGGG - Intronic
1153402042 18:4691918-4691940 ACAACAGGAGGGACAATGATCGG + Intergenic
1153560319 18:6365983-6366005 CAAACAGGGTGCACTCTGTTAGG + Intronic
1153574074 18:6503407-6503429 CAAAGAGGAGGGAAGCGGATCGG + Intergenic
1154041456 18:10860020-10860042 CAGACAGGAGGGAGGCAGATTGG + Intronic
1155372881 18:25121665-25121687 ACAACAGGAGGGGCTCTGAGAGG + Intronic
1155717931 18:28970019-28970041 CAAAAAGGCAGGACTCTGAGAGG - Intergenic
1155927679 18:31674263-31674285 CAAGCCGGAGTGACTCTGAGGGG + Intronic
1156074088 18:33251527-33251549 TAAACATGAGGGCCTCTAATTGG + Intronic
1160010601 18:75104740-75104762 CAAACAGCTGGGACCCTGAGGGG - Intergenic
1162386301 19:10362251-10362273 CAACCAGGAGGTACGATGATAGG - Exonic
1163604961 19:18269208-18269230 CCAACAGGAGGTAGACTGATGGG + Intronic
1165878624 19:39027158-39027180 CAGACAGGAGTGTCTTTGATGGG + Intronic
1168162598 19:54521609-54521631 CAAACAGGAAGGACGCAGACGGG + Intergenic
1168164192 19:54535471-54535493 CAAACAGGAAGGACGCAGACGGG + Intronic
1168578448 19:57533601-57533623 AATTCAGGAGGCACTCTGATAGG - Intronic
926045414 2:9706264-9706286 CAAACATCAGGGCCTGTGATGGG + Intergenic
926750586 2:16195825-16195847 CACACAGGCGGGCATCTGATGGG + Intergenic
927078975 2:19609359-19609381 CAAACAGTAGAGACTGTGCTTGG + Intergenic
927997832 2:27498501-27498523 CATACTGGCGGGACTCAGATGGG - Intronic
931191661 2:60007140-60007162 CACAAAGTAGGGAGTCTGATGGG - Intergenic
931347049 2:61456324-61456346 CAAAGAGGATGGACTTTGATTGG - Intronic
933776566 2:85774599-85774621 CAGCCAGGAGGGGCTCTGGTGGG - Intronic
934988491 2:98904125-98904147 CAAACAGAAGGAACACTGAGTGG + Intronic
935589170 2:104830003-104830025 CAAACAGGAGAAACTCTGCTGGG + Intergenic
935756920 2:106283586-106283608 CAAAGAGAAGGGGCTCTGTTGGG + Intergenic
936112646 2:109677450-109677472 CAAAGAGAAGGGGCTCTGTTGGG - Intergenic
936170059 2:110162855-110162877 TAAACAGGCTGGCCTCTGATAGG + Intronic
937882328 2:126877822-126877844 CACACAGGAGGGACACTGAGAGG + Intergenic
945932258 2:215866742-215866764 CAAACAGGAAGGACTCTCAGTGG + Intergenic
946731032 2:222709624-222709646 CAGGCTGGAGGGATTCTGATTGG + Intronic
946973368 2:225120396-225120418 CAAACACAAGGCACTCTAATGGG + Intergenic
1172486908 20:35303931-35303953 CAACGACGAGGGACTTTGATGGG - Exonic
1172753652 20:37268542-37268564 CAAACAGAAGGGCCTGTGATTGG + Intergenic
1173175274 20:40760184-40760206 CAAACAGAAGGGACTCGGGTTGG + Intergenic
1173399049 20:42708319-42708341 CAGACAGGATAGACTCTAATAGG + Intronic
1173790849 20:45826937-45826959 CACACAGTGGGGACTCTGAGGGG - Intronic
1174082168 20:47978264-47978286 CACACAGGAGGGGCTGTGAGCGG + Intergenic
1174134314 20:48368522-48368544 CACACAGGAGGGGCTGTGAGCGG - Intergenic
1175281894 20:57809378-57809400 CAAACATAAGGGACTGTGGTAGG - Intergenic
1175460245 20:59146879-59146901 AAAATAGAAGGGACTCTAATAGG + Intergenic
1181099755 22:20531393-20531415 CATAAAGGAGGGGCTCTGAGAGG - Intronic
1181477745 22:23179375-23179397 CACTCTGCAGGGACTCTGATGGG - Intergenic
1181782893 22:25205869-25205891 AAAGCAGGAAGGACTCAGATGGG - Intronic
1182241679 22:28921025-28921047 CAAACAGGAGGGAAGATGAAAGG + Intronic
1184428929 22:44429831-44429853 CTAACTGCAGGCACTCTGATGGG - Intergenic
1184627127 22:45744016-45744038 CAACCAGGAGGGAGTCTAAGGGG - Intronic
952379251 3:32791761-32791783 CAAGCAGAAGGGATTCTGAGGGG - Intergenic
953416570 3:42723334-42723356 CAAACAGGAGGCTCTCTGAGTGG - Intronic
954862451 3:53702247-53702269 CAAAGAGGAGGGACCCAAATGGG - Intronic
955054704 3:55445001-55445023 GACTCAGGAGGGTCTCTGATGGG - Intergenic
956913168 3:73842568-73842590 CAAACACGGGGGACTGTCATGGG - Intergenic
957145875 3:76423060-76423082 GAAACAGGAGGGACAGTGAAAGG + Intronic
957593019 3:82225133-82225155 CCCACAGCAGGGTCTCTGATTGG + Intergenic
959268245 3:104171315-104171337 GAAACAGGGAGGACTCAGATGGG + Intergenic
960303773 3:116036227-116036249 GAAACATGAGGGACTCTGAGAGG - Intronic
961656299 3:128444014-128444036 CAAGCAAGAGGGAGTCTGGTGGG + Intergenic
961853919 3:129850408-129850430 TTCACAGAAGGGACTCTGATAGG - Intronic
963579058 3:147100968-147100990 GATTCAGGAGTGACTCTGATTGG + Intergenic
964396915 3:156255442-156255464 GAAACAGCAGGGACTCTGACTGG - Intronic
969962374 4:10958342-10958364 CCAACAGCAGGAGCTCTGATGGG - Intergenic
970275668 4:14397795-14397817 CACACAGCAGGGACTGTTATGGG - Intergenic
971091150 4:23347144-23347166 GAAACAGGGGAGACACTGATTGG - Intergenic
971232656 4:24812523-24812545 CAAACAGGAGGGACTCTATGGGG - Intronic
975470083 4:74755858-74755880 CACACAGGAGGGCGTCTGCTCGG + Exonic
978449779 4:108819711-108819733 GTAACAGGAGGGTTTCTGATTGG - Intronic
982574532 4:157092856-157092878 TAAACAAGGAGGACTCTGATAGG - Intronic
984568045 4:181354924-181354946 CAAGCAGGAGGTAATCTGGTAGG + Intergenic
986299610 5:6467698-6467720 CAAACAGGAGGACATCTGAGAGG - Intronic
993264346 5:85704738-85704760 CAGGTAGGAGGGAGTCTGATTGG - Intergenic
996851668 5:127959912-127959934 CAAACAGGTGGGCCACTCATGGG + Intergenic
997194683 5:131970863-131970885 CAAACAGGTGGGGCTCTGGAGGG - Intronic
1000157365 5:158564705-158564727 CCTAGAGGAGGGACTCTGATTGG - Intergenic
1001687157 5:173602295-173602317 GAGACTGGAGGGACACTGATGGG + Intergenic
1001789908 5:174447160-174447182 CTCCCAGGAGGGATTCTGATTGG + Intergenic
1003515851 6:6818246-6818268 CAAACAGAAGTGAATATGATGGG - Intergenic
1004197220 6:13515925-13515947 CAAACAGGAGGTACTTTAAAAGG - Intergenic
1005586372 6:27280099-27280121 AAAACAGGAAGGGCTCTGGTGGG + Intergenic
1005680276 6:28199751-28199773 AAAACAGGAGGGCCACTTATTGG + Intergenic
1006363312 6:33599663-33599685 CAAACAGTAGGGACTGGGGTGGG - Intergenic
1007384490 6:41511467-41511489 CCCACAGGAGGCACTCTGATGGG - Intergenic
1007640735 6:43337538-43337560 CAAACAAGAGTCACTCGGATTGG - Exonic
1008078435 6:47170054-47170076 CAAACAGGAGGAGCCATGATAGG + Intergenic
1008367638 6:50701286-50701308 AAAACAGGAAGAACTCTGGTTGG + Intergenic
1009995562 6:70891579-70891601 CAAACAGGACAGGCTCTGAGGGG + Intronic
1017293843 6:152771871-152771893 GAAACAGGAGATACTATGATGGG + Intergenic
1024595759 7:50935829-50935851 CATTCAGGAGAGACTCTGAAAGG - Intergenic
1027420814 7:78016030-78016052 AACAGAGGAGGGACTCAGATGGG - Intergenic
1030882716 7:114901119-114901141 GAAACAGGATGGGCTCAGATGGG + Intergenic
1033287718 7:140056876-140056898 AAAAGAGGAGGCACTCTGCTGGG + Exonic
1034748896 7:153550018-153550040 AAAACAGGATGGAGTCTGACTGG - Intergenic
1036103167 8:5810115-5810137 CTAACAGGAGAGACTCATATTGG - Intergenic
1037123926 8:15321695-15321717 ACAACAGGAGGGACCCTGAATGG - Intergenic
1037699755 8:21263674-21263696 CACCCAGGAGTTACTCTGATGGG - Intergenic
1041133771 8:54733890-54733912 CAAACAGGAGTGACTGTGTTTGG + Intergenic
1042009726 8:64229151-64229173 GAAACAGGAATGACTCTAATGGG + Intergenic
1042178227 8:66058656-66058678 GACACAGGAGGGACTGAGATAGG - Intronic
1047389825 8:124441139-124441161 CCAACAGAAGGGACTCTGAGTGG + Intergenic
1048739197 8:137535807-137535829 CAAACAGGCAGGACCCTGAAGGG + Intergenic
1049683956 8:143931840-143931862 CAGACAGGAGGGCTCCTGATTGG + Intronic
1051097548 9:13483899-13483921 AACACCGAAGGGACTCTGATGGG - Intergenic
1055292037 9:74792202-74792224 CATACTTGAGGGACTCTGATAGG + Intronic
1056456103 9:86762542-86762564 AAAAGAGGAGGGATTCTGATGGG - Intergenic
1057574115 9:96227580-96227602 CATACAGGATGGACTCTTTTGGG - Intergenic
1061379403 9:130244955-130244977 CCCATAAGAGGGACTCTGATTGG + Intergenic
1062258751 9:135646426-135646448 CCAACAGAAGGAACTCTGAGTGG + Intergenic
1062665740 9:137670531-137670553 CAAAGAGGAGGGAGGCAGATGGG - Intronic
1189863656 X:45300477-45300499 CCAACAGAAGGGATTCTGAGTGG + Intergenic
1191267418 X:58412945-58412967 CAAAAAGCAGTGTCTCTGATTGG + Intergenic
1197809941 X:130432362-130432384 GAAACAGGAAAGACTCTGAGAGG - Intergenic
1198095123 X:133372421-133372443 GAAAAAGGAGGGACTTTGAAAGG - Intronic
1198889026 X:141371603-141371625 CAAACACCAGGGTCTCTTATGGG + Intergenic
1199683394 X:150242987-150243009 CAGGCAGGAGGGAGGCTGATTGG + Intergenic