ID: 1132422126

View in Genome Browser
Species Human (GRCh38)
Location 15:101679177-101679199
Sequence AGCTGACAACTTGCCAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 1, 2: 13, 3: 80, 4: 335}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132422126 Original CRISPR AGCTGACAACTTGCCAAATT TGG (reversed) Intronic
900859090 1:5212590-5212612 ATGTTAAAACTTGCCAAATTAGG + Intergenic
902911138 1:19597878-19597900 AGCTAACAAATGGCAAAATTAGG + Intronic
904294730 1:29512107-29512129 GGCTGAAAACTTCCTAAATTTGG + Intergenic
905044648 1:34986027-34986049 ATCAGACATCTGGCCAAATTTGG - Intronic
905162406 1:36047898-36047920 AGCTGAAAACTTCCCAAATCTGG + Intronic
907229548 1:52983362-52983384 GGCTGAAAACTTGCCAAATTTGG - Intronic
908334555 1:63107940-63107962 AAGGGACAACATGCCAAATTGGG + Intergenic
908696652 1:66850010-66850032 AGCTGAAAACTTCCAAAATTTGG + Intronic
908885951 1:68788216-68788238 AGTTGAAAATTTCCCAAATTTGG + Intergenic
909081436 1:71117319-71117341 TGCTGACATTTTACCAAATTTGG + Intergenic
909536689 1:76744960-76744982 GGCTAAAAACTTCCCAAATTTGG - Intergenic
911984502 1:104603522-104603544 AGCTGAAAACTTCCCAAATCTGG + Intergenic
911986008 1:104622607-104622629 GGCTTAAGACTTGCCAAATTTGG + Intergenic
912024809 1:105156769-105156791 AGCCGAGAACTTGCAACATTTGG - Intergenic
913030214 1:114894405-114894427 AGCTGACAGCTGGACATATTAGG + Intronic
913194059 1:116440165-116440187 AGTTGAAAATTTCCCAAATTTGG - Intergenic
913218486 1:116640411-116640433 AAATGACAACATCCCAAATTTGG + Intronic
914394236 1:147249757-147249779 AGCTGAAAACTTCCCAAATCTGG - Intronic
915374834 1:155384810-155384832 AACTGGAAACTTACCAAATTTGG - Intronic
915785210 1:158603401-158603423 AGCTGAAAACTTCCCAAATTTGG + Intergenic
915862606 1:159462187-159462209 GGCCGAGAACTTCCCAAATTTGG - Intergenic
916365213 1:164018616-164018638 AACAGAAAACTTTCCAAATTTGG + Intergenic
917511181 1:175670441-175670463 AGCTCACAAATTGCCAACATGGG - Intronic
919885805 1:201933913-201933935 AGCTGATAAATAGCCAAGTTGGG + Intronic
921991124 1:221369023-221369045 ATCTGAAAACTTGCCAAATTTGG - Intergenic
922370187 1:224902155-224902177 AGTTGACAGCTTCCCTAATTAGG - Intronic
923004534 1:230036366-230036388 GGCTGAAAACTCCCCAAATTTGG - Intergenic
924159347 1:241214545-241214567 GGCTGAAAATTTTCCAAATTTGG - Intronic
924637914 1:245806554-245806576 AACTGACACCTTGCCAACTTGGG + Intronic
1062900989 10:1146856-1146878 AGCTGAAAATTGGCCAAATTTGG - Intergenic
1063591999 10:7404361-7404383 AGAAAACAACTTGCCAAGTTTGG + Intronic
1065050932 10:21790280-21790302 AGTTGAAAACTTCCCAAATCTGG + Intronic
1065227979 10:23566253-23566275 GGCTGAAAACTTCCCAAATCTGG - Intergenic
1066356417 10:34688480-34688502 AATTGACATTTTGCCAAATTAGG - Intronic
1066441055 10:35439148-35439170 AGCTGAAAAGTTCCCAAATTTGG - Intronic
1067762880 10:49062645-49062667 GGCTGAAAACTCCCCAAATTTGG - Intronic
1068157034 10:53213621-53213643 AGCTGAAAACTTCCTAAATCTGG - Intergenic
1068326368 10:55493143-55493165 GACTGAAAACTTGCCAAATTTGG + Intronic
1069588245 10:69624228-69624250 GGCTAAAAACTTTCCAAATTTGG + Intergenic
1071067607 10:81655271-81655293 ATCAGAAAAGTTGCCAAATTTGG - Intergenic
1071193640 10:83131453-83131475 AGTAGAAAACTTTCCAAATTAGG + Intergenic
1071833292 10:89393408-89393430 AGCTGAGAAATTCCCACATTAGG - Intronic
1072283636 10:93893289-93893311 ATCTTACATCTGGCCAAATTAGG + Intergenic
1074036056 10:109739801-109739823 AGCTGACCACTAGCTAAATGTGG + Intergenic
1074064683 10:110003270-110003292 AGCTGAGAAGTTGTTAAATTGGG + Intronic
1074408320 10:113200568-113200590 GGCTGAAAACTTTCCAAATCTGG + Intergenic
1075680759 10:124329575-124329597 TGCTGAGAACTTGTAAAATTAGG + Intergenic
1076409905 10:130241087-130241109 AGCTAAAAATTTTCCAAATTAGG - Intergenic
1078028349 11:7721573-7721595 GGCTGAAAACTTCCCAAATCTGG - Intergenic
1078384101 11:10872582-10872604 AGCTGACAACTTCCCAAGTCTGG - Intergenic
1078404028 11:11053494-11053516 GGCTGAAAACTTCCCAGATTTGG - Intergenic
1078491613 11:11774630-11774652 AGCTGACAACTCTACATATTAGG - Intergenic
1078500125 11:11865198-11865220 TGCTGAAAACTTCCCAAATTTGG - Intronic
1078769647 11:14336832-14336854 AGCTGAAAACTTCCCAAATGTGG + Intronic
1079394294 11:20048770-20048792 AGCTGAAAACATGAAAAATTCGG + Exonic
1080016777 11:27516058-27516080 AGCTGAGATCATGCCAAAGTTGG - Intergenic
1080558390 11:33438458-33438480 AGCTGACATCTCTCCAATTTTGG - Intergenic
1081985905 11:47303981-47304003 AGCTGAAAACTTCCCAAGTCTGG - Intronic
1084416439 11:69035535-69035557 TGCTGAAAACTTGCCTTATTTGG + Intergenic
1084525131 11:69692598-69692620 GGCTGAAAACTTCCCCAATTTGG + Intergenic
1085369090 11:75981411-75981433 GGCTAAAAACTTGCCAAATTAGG - Intronic
1085688068 11:78643389-78643411 AACTGAAAACTTTCCGAATTTGG - Intergenic
1085864393 11:80271951-80271973 TGCTGAAAACTTCCCAAATCTGG + Intergenic
1085998082 11:81946762-81946784 AGCTGACAACTTCCAATATGAGG - Intergenic
1086306147 11:85483034-85483056 AGCAGAAAACTTTTCAAATTTGG + Intronic
1087055173 11:93928264-93928286 AACTGACATCTTGTCAAAATTGG - Intergenic
1087098381 11:94341829-94341851 ACCTGAAAACTTCTCAAATTTGG + Intergenic
1087205966 11:95394052-95394074 GGCTGAAAACCTCCCAAATTAGG + Intergenic
1087393227 11:97566078-97566100 AGATGAAAACTTTTCAAATTTGG + Intergenic
1087431034 11:98055725-98055747 AGCAGACACCATACCAAATTAGG - Intergenic
1088178703 11:107083901-107083923 AGCTGAAAACGTTCCAAATTTGG - Intergenic
1088601321 11:111478962-111478984 AGCTGAAAACTTTCCAAATTTGG + Intronic
1089570428 11:119404487-119404509 ACCTGAAATCTTGCCAAATATGG - Intergenic
1089957783 11:122588006-122588028 GGCTGGAAACTTCCCAAATTTGG - Intergenic
1090564519 11:127973010-127973032 GGCTGAAAACTTCCCAAATTTGG + Intergenic
1092504624 12:9083775-9083797 GGCTGAAAACTTCCCTAATTAGG + Intronic
1093272303 12:17079879-17079901 AGCAGAAAACTTCCCAAATTTGG - Intergenic
1093607825 12:21114635-21114657 AGCTAATATCATGCCAAATTGGG - Intronic
1093666591 12:21821097-21821119 AGCTGACTATTTTCCAACTTAGG + Intronic
1094177515 12:27556573-27556595 AACTGACAACTTTCCCAATGCGG - Intronic
1094251506 12:28367586-28367608 AGCTCACAATTTCCCAAATTTGG + Intronic
1094532420 12:31289257-31289279 GGCTGAAAACTTGTGAAATTTGG + Intronic
1094758940 12:33505803-33505825 GACTGACTACTTCCCAAATTAGG - Intergenic
1095284208 12:40389222-40389244 AGCAGACACCCTGCCAAATCTGG - Intergenic
1095660538 12:44728577-44728599 AGCTGAAAACTTCCCAAATCTGG + Intronic
1095897847 12:47298526-47298548 GGCTGAAAACTCTCCAAATTTGG - Intergenic
1096341061 12:50799953-50799975 GGCTGAAAAATTACCAAATTTGG + Intronic
1096562750 12:52448522-52448544 ACCTGACATCTTGCCCAACTTGG + Intronic
1097529825 12:60784450-60784472 AGAAGAAAACTTCCCAAATTTGG + Intergenic
1098196641 12:68009024-68009046 AGCTGTCAAATGGCCAAGTTTGG - Intergenic
1098414048 12:70213700-70213722 AGCAGAAAACTTCCCAAATCTGG - Intergenic
1100342429 12:93692321-93692343 AGCAGAAAACTTTCCAAATCTGG + Intronic
1100360102 12:93869884-93869906 GGCTGAAAATTTTCCAAATTTGG + Intronic
1104484790 12:129141670-129141692 AGCTGAAAACTTGCAGTATTTGG - Intronic
1104825337 12:131704033-131704055 AGCTGAGAAGTTCCCAAATCTGG + Intergenic
1106239406 13:27898469-27898491 GGCTGAAAACTTCCTAAATTTGG - Intergenic
1106649332 13:31672738-31672760 AGCTGAGAACTCCCCAAATTTGG - Intergenic
1108432317 13:50366663-50366685 AGCTGGCAAAAAGCCAAATTAGG - Intronic
1109117817 13:58410984-58411006 AGCTGAAAATGTCCCAAATTTGG + Intergenic
1111485996 13:88899866-88899888 GGCTGAAAACTTCCTAAATTTGG - Intergenic
1111900342 13:94192316-94192338 AGCTGGCATTTTGCCACATTGGG + Intronic
1112480114 13:99767494-99767516 GGCTGAAAACTCTCCAAATTTGG - Intronic
1113204847 13:107905478-107905500 AGTTGACTTCTTGCGAAATTTGG + Intergenic
1113726640 13:112608403-112608425 ATCTGAAAACTTTCCAGATTTGG + Intergenic
1114879301 14:26764034-26764056 AACTGACAGCTTGACATATTTGG - Intergenic
1115669983 14:35600030-35600052 TGCTGAAAACTTCCTAAATTTGG - Intronic
1115975978 14:38997590-38997612 AAATGTAAACTTGCCAAATTTGG - Intergenic
1116509389 14:45725196-45725218 GGCTGGAAACTTCCCAAATTGGG - Intergenic
1117345127 14:54824160-54824182 GGCTGAAAACTTTCCAAACTTGG + Intergenic
1117759398 14:59011026-59011048 AGCAGAAAACTTTCCAAATCTGG + Intergenic
1118562884 14:67106346-67106368 AGCTGAAAACTTCCCAAGTCTGG - Intronic
1119202561 14:72767737-72767759 GGCTGAAAAATTCCCAAATTTGG + Intronic
1120022221 14:79543619-79543641 AGCTGAGACCTTGAAAAATTTGG + Intronic
1121195370 14:92067323-92067345 GGCTGAAAATTTCCCAAATTTGG - Intronic
1122358216 14:101137069-101137091 AACTGACAGCTTCCCTAATTTGG + Intergenic
1123460690 15:20467364-20467386 GGCTTACAAGTTCCCAAATTTGG + Intergenic
1123657371 15:22533052-22533074 GGCTTACAAGTTCCCAAATTTGG - Intergenic
1124311283 15:28628261-28628283 GGCTTACAAGTTCCCAAATTTGG - Intergenic
1124912162 15:33932233-33932255 AGTTCTGAACTTGCCAAATTGGG - Intronic
1125804543 15:42481882-42481904 GGCTGAAAATTTCCCAAATTTGG - Intronic
1126236540 15:46391598-46391620 AGCTGAAAACTTCCCAAACCTGG + Intergenic
1126294329 15:47120489-47120511 GGCTGACAATTTCCCAAATTTGG + Intergenic
1126306096 15:47259723-47259745 AGCTGAAAACTTCCCAAATTTGG - Intronic
1128438951 15:67685051-67685073 GGCTGAAAACTTTCCAAATTTGG + Intronic
1129179401 15:73863175-73863197 GGCTGAAAACGTCCCAAATTTGG + Intergenic
1129179455 15:73863901-73863923 GGCTGAAAACGTCCCAAATTTGG + Intergenic
1129625432 15:77193249-77193271 AGCTGAAAACTAGACAAAGTAGG + Intronic
1130392589 15:83472247-83472269 GGTTGAAAACTTTCCAAATTTGG - Intronic
1130544781 15:84847385-84847407 GGCTGAAAACTTTCAAAATTTGG + Intronic
1131987366 15:98057465-98057487 AGCTGAAAACTTCCCAAGTCTGG - Intergenic
1132422126 15:101679177-101679199 AGCTGACAACTTGCCAAATTTGG - Intronic
1132620522 16:865685-865707 AACTGAAAACTTCCCAAATTTGG - Intronic
1137361678 16:47822734-47822756 TGTTGACAACTTCCCAAATTTGG + Intergenic
1137577427 16:49609783-49609805 GGCTGAAAAATTCCCAAATTTGG + Intronic
1137938724 16:52660047-52660069 AGCTTAAAACTTCCCAAGTTTGG + Intergenic
1138312305 16:56037994-56038016 GGCTGAAAACTTCCCAAATTTGG - Intergenic
1140669453 16:77262217-77262239 AGCTGAAAACTCTCCAAATTTGG - Intronic
1140703067 16:77600725-77600747 AGTTGAAAACTTCCCAAATTTGG + Intergenic
1143287796 17:5803539-5803561 GGCTGAAAACTTGCCAAATTTGG - Intronic
1144161360 17:12562953-12562975 GGCTGAAAACTTCCCAAGTTTGG - Intergenic
1145073743 17:19833909-19833931 GGTTGACAACTCCCCAAATTTGG + Intronic
1145097172 17:20040858-20040880 AGCTGAAAACTTCCCAAATTTGG - Intronic
1146751431 17:35384836-35384858 AGGTGAAAACATGCCATATTTGG + Intergenic
1147901634 17:43790238-43790260 GGCTGAAAACTTCCCAAATCCGG - Intergenic
1148112150 17:45151038-45151060 ACCTAACAAACTGCCAAATTAGG - Exonic
1148396569 17:47312911-47312933 TCCTGACAAGTTGCCATATTAGG + Intronic
1149092319 17:52798534-52798556 AGCTGAAAACTTTCCAAATCTGG + Intergenic
1150177011 17:63067909-63067931 AGCTGGGAATTTGTCAAATTTGG + Intronic
1151934192 17:77251720-77251742 GGCTGAAAACTTTCCAAATCTGG - Intergenic
1152996548 18:412061-412083 GGCTGAACACTTCCCAAATTTGG + Intronic
1155123983 18:22853016-22853038 AGCTAAAAACTTCTCAAATTTGG - Intronic
1155124311 18:22856368-22856390 AGATCACAACTTGCCAATTTAGG + Intronic
1155478387 18:26259136-26259158 AGCTGAAAGCTTCCCAAATTTGG - Intronic
1156075353 18:33270337-33270359 GGCTGAAAACTTGCAAAATTTGG + Intronic
1156093277 18:33497559-33497581 AGCCGAAAACTGCCCAAATTCGG - Intergenic
1156418375 18:36923429-36923451 AGAAGACAAATTACCAAATTAGG + Intronic
1157630399 18:49089599-49089621 TGCTGATAACCTGCCAGATTTGG - Intronic
1157757644 18:50232699-50232721 AACTGATAACTTGCAAAGTTGGG + Intronic
1157985916 18:52437183-52437205 AGATGGCAAATTGCCAAATGGGG + Intronic
1158109561 18:53926109-53926131 AGCTGAAAACTTTCTGAATTTGG + Intergenic
1158909775 18:62048295-62048317 GGCTGAAAAGTTTCCAAATTTGG + Intronic
1164751055 19:30654968-30654990 AGGTGACAGCTTGAGAAATTTGG - Intronic
1166625422 19:44348241-44348263 AGCTGAAAATTGCCCAAATTTGG - Intronic
1168225628 19:54992886-54992908 AGTTGACAACTTAGCAAAATAGG - Intronic
925550329 2:5066934-5066956 AGGTGAGAACATGCCATATTTGG - Intergenic
926543409 2:14208932-14208954 AGCAGACAACATGGCATATTAGG - Intergenic
926806692 2:16717609-16717631 TGTTGACAACTTGGCAAATTCGG - Intergenic
927176094 2:20409480-20409502 AGCTGAAAACTTCCCAAGTCTGG - Intergenic
927352067 2:22127259-22127281 AGCAGAAAACTTTCCAAATCTGG + Intergenic
928251016 2:29680225-29680247 GGCCTAAAACTTGCCAAATTTGG - Intronic
930155210 2:48099908-48099930 GGCTGAAAACTCTCCAAATTTGG + Intergenic
931068326 2:58613389-58613411 AGCTGACAATTTACAAACTTTGG + Intergenic
932872032 2:75410652-75410674 AGCAGAAAACTTTCCAAATTGGG + Intergenic
933597068 2:84292749-84292771 TGCTGATAACTGGCCAAGTTGGG - Intergenic
934879053 2:97957211-97957233 TGCTTAGAAGTTGCCAAATTTGG - Intronic
934908102 2:98223439-98223461 AGCTGAAAACTTCCCAAAGTTGG + Intronic
935126512 2:100228417-100228439 GGCTGAAAACTTCTCAAATTTGG + Intergenic
935187777 2:100749680-100749702 AGCTGAAAACTTCCCAAATTTGG + Intergenic
935962790 2:108443964-108443986 AGCTTAAAATTTCCCAAATTAGG + Intergenic
936726328 2:115321574-115321596 GGCCAACAACTTGCCAAATTTGG - Intronic
936756217 2:115715538-115715560 AGCTAACAAATTACCAAATATGG - Intronic
937129618 2:119497980-119498002 GGCTGAAAACTTCCCAAATTTGG + Intronic
937328950 2:121011164-121011186 GACTGAAAACTTCCCAAATTTGG + Intergenic
937426337 2:121802328-121802350 GATTGAAAACTTGCCAAATTTGG + Intergenic
937834679 2:126460223-126460245 GGCTTATATCTTGCCAAATTAGG - Intergenic
938061199 2:128255772-128255794 GGCTGAAAACTTGTCAAATTTGG + Intronic
938126226 2:128673303-128673325 GGCTGAAAAGTTCCCAAATTTGG + Intergenic
939197000 2:138985450-138985472 AGCTGAAAGCTTACCAAATCTGG - Intergenic
939446373 2:142314881-142314903 AGCTGACAATTTGTTTAATTAGG - Intergenic
939595144 2:144113553-144113575 GGCTGAAAATTTCCCAAATTTGG + Intronic
940463735 2:154002213-154002235 GGCTGAAAACTTTCCAAATATGG - Intronic
940685612 2:156846685-156846707 TGCTGAAAACCTGCCAATTTAGG - Intergenic
940723630 2:157309296-157309318 AGCTGGAAACTGGCCATATTGGG + Intronic
940970542 2:159892083-159892105 ACCTGGAAACTTGCCAAATTTGG + Intronic
941221254 2:162784643-162784665 ACCTGCAAACTTGGCAAATTTGG + Intronic
942330135 2:174814936-174814958 AGCTGAAAACTCCCCAAATATGG - Intronic
943040046 2:182793607-182793629 TGCTGCCAACTTGCCTTATTTGG - Exonic
943894304 2:193333723-193333745 AAATGACAAGTTGGCAAATTTGG + Intergenic
944432846 2:199653635-199653657 GGCTGAAAACTCCCCAAATTTGG - Intergenic
948228287 2:236330243-236330265 AACAGACAACAGGCCAAATTTGG - Intronic
1168781595 20:496223-496245 AGCAGACATCAGGCCAAATTTGG - Intronic
1168900117 20:1356530-1356552 AGCTGAAAACTCCCCAAATTTGG - Intronic
1168905058 20:1396550-1396572 GGCTGAAAACTTCCCAAATGTGG - Intergenic
1169007380 20:2219848-2219870 GGATGAAAACTTTCCAAATTTGG - Intergenic
1169290987 20:4352577-4352599 GGCTGAATACTTCCCAAATTTGG - Intergenic
1169469669 20:5873041-5873063 GGCTGAAAACTTCCCAAATTTGG + Intergenic
1171289155 20:23970570-23970592 AATTTACAATTTGCCAAATTTGG + Intergenic
1172634069 20:36397819-36397841 AGCTTAAAACTTGGCAAATTAGG + Intronic
1173708531 20:45134577-45134599 AGCAGAAAACTTTCCAAATCTGG - Intergenic
1173769254 20:45644170-45644192 AGCAGAAAAATTTCCAAATTGGG - Intergenic
1173909630 20:46656663-46656685 GGCTGAAAACTTCCCAAATTTGG - Intronic
1174956186 20:55101221-55101243 GGCTGAAAACTCCCCAAATTTGG - Intergenic
1176371460 21:6064498-6064520 AGCAGAAAACTTCCCAAATTTGG - Intergenic
1177996486 21:28106542-28106564 GACTGAAAACTTCCCAAATTTGG - Intergenic
1178526385 21:33332949-33332971 AGCTGAAAACTTCCCAAGTCTGG + Intronic
1178566270 21:33689327-33689349 AGCTGTCACCTTCCCAAATGCGG + Intronic
1178572052 21:33747433-33747455 AGCCAAACACTTGCCAAATTTGG + Intronic
1178784130 21:35636722-35636744 GGCTGACAACCTGCCATAGTAGG - Intronic
1179752059 21:43474041-43474063 AGCAGAAAACTTCCCAAATTTGG + Intergenic
1181485501 22:23228901-23228923 AGCTGAACACTTCCCAAATTAGG - Intronic
1182030552 22:27156107-27156129 AGCTGAGACTTTGCCAAAATGGG + Intergenic
1182986775 22:34725982-34726004 GGCTGAAAACTTCCCAAATCTGG + Intergenic
1183834924 22:40444400-40444422 TGCCGAAAACTTCCCAAATTTGG + Intronic
1184435922 22:44476152-44476174 AGCTGAAAATTTCCCAAATTTGG - Intergenic
949164962 3:928594-928616 ATATGACAACTTGCTAAAGTAGG - Intergenic
949595829 3:5546491-5546513 AGCTGAAAACTTCTCAAATCTGG - Intergenic
950275692 3:11658576-11658598 AGCTGACAATTTTACAAACTAGG + Intronic
953275901 3:41497488-41497510 AGCTCATAGTTTGCCAAATTTGG + Intronic
953467545 3:43136680-43136702 AGCTGAAAAGTTCCCAAATTTGG - Intergenic
954489893 3:50893735-50893757 GGCTGAAAACTTCCCAAATCTGG + Intronic
955160074 3:56456629-56456651 AGCTAACCACTAGCCATATTGGG + Intronic
956263009 3:67365247-67365269 AGTTGAAAATTTACCAAATTTGG + Intronic
957001356 3:74889360-74889382 GACTGAAAACTTTCCAAATTTGG - Intergenic
958744474 3:98115730-98115752 AGCCGAAAACTTCCCAAGTTTGG - Intergenic
958835070 3:99135783-99135805 AGCTGAGAACATTCTAAATTAGG - Intergenic
959518567 3:107299279-107299301 AGCTGAAAATTTCACAAATTTGG - Intergenic
961395166 3:126581697-126581719 AGCTGAGAATTTTCCAAACTTGG + Intronic
962032823 3:131619303-131619325 AGCTGACAACTGGACAAATAGGG + Intronic
962239554 3:133740374-133740396 AGCTGAGATCATGCCACATTAGG - Intergenic
962433165 3:135338879-135338901 GGCTGAAAACTTCCCAAATCTGG + Intergenic
963721640 3:148868237-148868259 AGCTGACAATTTCAAAAATTTGG - Intronic
965840488 3:172900453-172900475 GGCTGAAAACTTCCCAAATTTGG - Intronic
965877835 3:173349788-173349810 AGCAAACAACTTTCCAAATCTGG - Intergenic
966518272 3:180844570-180844592 ATCTGAAAACTTTCCAAATCTGG - Intronic
967301245 3:188016385-188016407 AGCTGAAAACTTCTCAGATTTGG - Intergenic
967562938 3:190938564-190938586 AGCTGACAACTTCCCAAATTTGG - Intergenic
970181774 4:13405126-13405148 AGCTGAAAATTTTCTAAATTGGG + Intronic
970183854 4:13428744-13428766 AGCCAAAAACTTCCCAAATTTGG + Intronic
970270049 4:14336803-14336825 AGCAGAAAAATTGCCAAATGGGG - Intergenic
971386449 4:26144690-26144712 AGCTGATGACTTGGGAAATTTGG + Intergenic
973222157 4:47739152-47739174 AGCTGAAAACTTCTCAAATTTGG + Intronic
973755174 4:54066961-54066983 AGCTGACAACTTCCCAAAGACGG + Intronic
974328092 4:60442512-60442534 AGCAGAAAACTTTCCAAATCTGG - Intergenic
974507716 4:62798196-62798218 AACTCAAAACTTGCCAAACTGGG + Intergenic
974685190 4:65217956-65217978 AGCAGAAAACTTTCCAAATCTGG + Intergenic
975858646 4:78652094-78652116 AGCTAATAGCTTGACAAATTAGG + Intergenic
976336182 4:83890199-83890221 AGCTGAAAACTTCCCAAATCTGG - Intergenic
976622095 4:87138969-87138991 GGCTGAAAACTTGCCTTATTTGG + Exonic
977178918 4:93848568-93848590 GGCTGAAAACTTCCCAAATTTGG + Intergenic
977691607 4:99918015-99918037 GGTTGAAAACTTCCCAAATTTGG - Intronic
977926616 4:102707022-102707044 AGCTGAAAACTTCCCAAGTCTGG + Intronic
977985612 4:103379642-103379664 AGGTGAGAACATGCCATATTTGG - Intergenic
978672451 4:111266870-111266892 ATCTGAGAAGTTGCCTAATTAGG + Intergenic
978675373 4:111308462-111308484 GGCTGAAAACTTCCCAAATCTGG - Intergenic
978996874 4:115168037-115168059 GGCTGAAAACTTCCCAAACTTGG - Intergenic
979398886 4:120223305-120223327 GGCTGAAAATTTTCCAAATTTGG + Intergenic
979617449 4:122759791-122759813 AGGTGACAACTTTCAAAATGTGG + Intergenic
980144742 4:128968122-128968144 GGCTGAAAACTTCCTAAATTTGG - Intronic
981190965 4:141862176-141862198 GACTGAAAACTTCCCAAATTTGG + Intergenic
981720788 4:147799376-147799398 GGCTGAAAACATTCCAAATTTGG - Intronic
982545903 4:156732673-156732695 GGCTGAAAACTTCCCAAATCTGG + Intergenic
983767331 4:171500753-171500775 ACCTGAAAATTTCCCAAATTTGG + Intergenic
984789154 4:183598669-183598691 GGCTGAAAACTTCCCAAATCTGG - Intergenic
984899655 4:184574038-184574060 AGCTGAAAACATCCCAAATTTGG + Intergenic
986134115 5:4958497-4958519 AGCTGACAACTTGGAGAATGAGG - Intergenic
987300517 5:16593551-16593573 TAATGACAGCTTGCCAAATTGGG + Intronic
987900705 5:24007704-24007726 AACTAAGAACATGCCAAATTTGG + Intronic
988417393 5:30962794-30962816 AGCTGATGATTTGCAAAATTTGG - Intergenic
989348872 5:40461049-40461071 AGCTGAAAATTTCCCAAATCTGG + Intergenic
990215591 5:53528546-53528568 GGCTGAAAACTTACCAAATTTGG - Intergenic
990363949 5:55050098-55050120 AGCTGAAAACTCCTCAAATTTGG - Intergenic
990433591 5:55764248-55764270 AGATGGCAACAGGCCAAATTAGG - Intronic
992189645 5:74278817-74278839 GGCTGAAAGCTTTCCAAATTTGG - Intergenic
993295886 5:86139388-86139410 AACTGACAACATCCTAAATTAGG + Intergenic
993542226 5:89166107-89166129 AGCTGTAAACTTGCTAAATAAGG - Intergenic
994640666 5:102405279-102405301 TGCTGAAAACTACCCAAATTTGG + Intronic
996109203 5:119545074-119545096 GACTGATAAGTTGCCAAATTTGG - Intronic
996445364 5:123542891-123542913 AGCTAAAAACTCCCCAAATTTGG - Intronic
996816207 5:127575293-127575315 AGCTGAAAACTCCCCAAATCTGG + Intergenic
997240758 5:132305381-132305403 GACTGAAAACTTCCCAAATTTGG + Intronic
998641826 5:144020439-144020461 AACTGACAGCTTCCCTAATTCGG + Intergenic
998660742 5:144234576-144234598 AGCTGACAAGTAGCAAAACTGGG - Intronic
998720807 5:144946497-144946519 GGCTGCCAACTTGCCGAATAAGG + Intergenic
998788479 5:145738782-145738804 AGCTGAAAACTTCCCAAATTTGG + Intronic
999096634 5:148984080-148984102 AGCTGAAAACGTCCCAAATCTGG - Intronic
999387957 5:151168937-151168959 AGCAGACAACCAGCCAGATTCGG + Intergenic
999902267 5:156097247-156097269 AGCTAAAAACTTTGCAAATTTGG - Intronic
1000248926 5:159474619-159474641 GGCTGAAAACTTTCCAAATGTGG - Intergenic
1000522357 5:162311576-162311598 ATCTGAAAACTCCCCAAATTTGG + Intergenic
1001943559 5:175758247-175758269 AGCTGAAACCTTCCCAAGTTTGG + Intergenic
1002321833 5:178381026-178381048 AGGTGAAAACTTGCAAAATTAGG - Intronic
1003355974 6:5370390-5370412 AGCTGACTATTTTCCAAGTTAGG + Intronic
1003520809 6:6856961-6856983 AGCTCACAACTTTCCATATGAGG + Intergenic
1004394837 6:15238655-15238677 AGCTTATCTCTTGCCAAATTGGG - Intergenic
1004565586 6:16793347-16793369 GGCTGAAAAGTTCCCAAATTTGG + Intergenic
1005171649 6:22992690-22992712 TGCTGAAAACTTCCCAAATTTGG - Intergenic
1006220562 6:32486163-32486185 GACTGACTACTTTCCAAATTTGG - Intergenic
1006261065 6:32871045-32871067 GGTTGAAAACTTCCCAAATTTGG + Intergenic
1007191068 6:40019099-40019121 GGCTGAAAACTTCCCAAATCTGG + Intergenic
1007874336 6:45078987-45079009 AGCTGAAAACTTCCCAAGTATGG - Intronic
1009591322 6:65674236-65674258 GGCAGAAAACTTCCCAAATTGGG + Intronic
1009663442 6:66645881-66645903 AGCAGAAAAGTTTCCAAATTTGG - Intergenic
1010372287 6:75124331-75124353 ATCTGAAAACTTACCAGATTGGG - Exonic
1010500082 6:76587904-76587926 ATCTTACAATTTGCCAATTTTGG + Intergenic
1011478894 6:87775038-87775060 GTCTGAAAACTTCCCAAATTTGG + Intergenic
1011865055 6:91815530-91815552 AGCTGGTAACTTTGCAAATTAGG - Intergenic
1012100220 6:95075133-95075155 TGCTGAAAACTCCCCAAATTTGG - Intergenic
1012748193 6:103122118-103122140 AAGTGAAAACTTGCCATATTTGG - Intergenic
1014131465 6:117839154-117839176 AGTTGACAACTTGCTTATTTAGG - Intergenic
1014207061 6:118667389-118667411 AGGTGACAACTAGCAATATTTGG + Intronic
1014541213 6:122678547-122678569 AGCTGAAAAATGTCCAAATTAGG - Intronic
1014601055 6:123412683-123412705 AGCTGGGAACTTACCAAACTCGG + Intronic
1014720001 6:124904737-124904759 AGCTAAAAACATTCCAAATTTGG + Intergenic
1014807779 6:125850133-125850155 AGCTGCCAACCTGAGAAATTTGG - Intronic
1015370854 6:132450875-132450897 AGCTGAAAACTCCCCAAAATTGG + Exonic
1015589809 6:134812409-134812431 ACCTCCCAACTTGCCACATTGGG - Intergenic
1016842658 6:148539969-148539991 TGTTGCCAACTTTCCAAATTTGG - Intronic
1017670431 6:156765097-156765119 AGCTGCCATCTTTCCAAACTCGG - Intergenic
1017704770 6:157111952-157111974 ATCTGAGAACTTGCCAAAAATGG - Intronic
1017868994 6:158470191-158470213 AGCAGACACCCTGCCAGATTCGG + Intronic
1018544171 6:164917680-164917702 AGCAGAAAACTCCCCAAATTTGG - Intergenic
1019753535 7:2749992-2750014 AGCAGAAAACTTTCCAAATTTGG + Intronic
1019764193 7:2837435-2837457 GGCTGAAAACTTCCCACATTTGG + Intronic
1020287815 7:6699015-6699037 CTCTGACCACTTTCCAAATTAGG + Intronic
1020921050 7:14264813-14264835 AGCAGAAAAGCTGCCAAATTTGG + Intronic
1022054161 7:26711961-26711983 AACTGGCAACTGACCAAATTAGG + Intronic
1023240082 7:38134822-38134844 CGCTGAAAACTTTCAAAATTTGG + Intergenic
1023544457 7:41303656-41303678 GGCTGAAAACTTCCCACATTTGG - Intergenic
1023925113 7:44662982-44663004 AGCTAAAAACTTCCCAAATATGG - Intronic
1024052784 7:45639527-45639549 AGCTGATAACCTGCCAAGCTAGG - Intronic
1024363680 7:48496979-48497001 AGCTGAAAACTTCCCAAGTTTGG - Intronic
1024375088 7:48628231-48628253 AGCTGACAACATGCCTACATAGG + Intronic
1025639829 7:63355556-63355578 AGCTGAAAACTTGCAAAATTTGG - Intergenic
1025642870 7:63392536-63392558 AGCTGAAAACTTGCAAAATTTGG + Intergenic
1025712309 7:63924742-63924764 AGCCGAAAACTTGCAAAATTTGG + Intergenic
1026066757 7:67081492-67081514 AGCTGAAAACTTCCCACATTTGG - Intronic
1027455388 7:78385069-78385091 AGCTGGGCACTTGTCAAATTGGG + Intronic
1027991469 7:85368424-85368446 AGCAGAAACCTTTCCAAATTTGG - Intergenic
1028301042 7:89201264-89201286 AGCTGACAAATTCCAGAATTAGG + Intronic
1028625919 7:92876743-92876765 AACTGAAAACTTCCCAAATCTGG + Intergenic
1028878789 7:95855486-95855508 AGCAGAAAGCTTTCCAAATTTGG - Intronic
1030402493 7:109069773-109069795 AGCTGAAAACTTCCTAAATATGG - Intergenic
1031296203 7:120007921-120007943 AGCAGAAAACTTTGCAAATTTGG - Intergenic
1031623390 7:123963773-123963795 AGCTTACAAATTGCTAAACTGGG - Intronic
1032315108 7:130830084-130830106 GGCTGAAAACTTCCCAAGTTTGG - Intergenic
1032773742 7:135088917-135088939 AGCTGAAAACTTCCCAAGTCCGG - Intronic
1033612002 7:142972145-142972167 AACTGAAAACTTCCCAAATTTGG + Intergenic
1035903268 8:3480532-3480554 TGCTGAAAACTTACCAAATTTGG + Intronic
1036159842 8:6377050-6377072 AGCTGGAAACTTACCAAATTTGG + Intergenic
1037439596 8:18902098-18902120 AACTGAAAACTTCCCAAGTTTGG - Intronic
1037984671 8:23282304-23282326 GGCTGAAAACTTTCCAAATTTGG - Intronic
1038138694 8:24819097-24819119 AGGTGTCCACTGGCCAAATTTGG - Intergenic
1038521557 8:28236855-28236877 AGCTGAAAACTTTCCAAATTTGG + Intergenic
1039014888 8:33136097-33136119 AGCTGAAAACTACCCAAATTTGG - Intergenic
1040059183 8:43089791-43089813 GGCTGAAAACTTCCCAAGTTTGG - Intergenic
1040918494 8:52588866-52588888 GGCTGAAAACTTACCAAATTTGG - Intergenic
1041113702 8:54512759-54512781 AGCTGACAATATCCCAAATTTGG + Intergenic
1041476260 8:58270321-58270343 AGCTGAACATTTCCCAAATTTGG - Intergenic
1041619374 8:59948278-59948300 AGCTTCAACCTTGCCAAATTTGG - Intergenic
1041759735 8:61351536-61351558 GGCTGAAAACTTCCCAAATTTGG + Intronic
1041827562 8:62113906-62113928 AGATGACAACATGCTATATTGGG - Intergenic
1042063483 8:64847153-64847175 ATCTCACCAGTTGCCAAATTTGG - Intergenic
1042465067 8:69120174-69120196 GGCTAAAAACTTCCCAAATTGGG - Intergenic
1043797185 8:84558314-84558336 ATCTGACAAGTTTCCAAATTAGG + Intronic
1044260463 8:90113973-90113995 AGTTGAAAACTTCTCAAATTTGG - Intergenic
1045185576 8:99834180-99834202 ATCAGACAATTTGCCAAATGTGG - Intronic
1045894095 8:107193673-107193695 AGCTGACAAGGTGCCTGATTCGG + Intergenic
1046066774 8:109206843-109206865 AGGTGAAACCTTTCCAAATTTGG - Intergenic
1046290461 8:112153401-112153423 AACTGACAACATGCCAAATGAGG + Intergenic
1046454175 8:114437431-114437453 GGTTGACTACTTACCAAATTTGG - Intergenic
1046536438 8:115518609-115518631 AACTGAAAGCTTGTCAAATTTGG - Intronic
1047285051 8:123480557-123480579 AGCTGACAGATTGACAGATTTGG + Intergenic
1047679654 8:127241545-127241567 AGCTGACAACTGGCAAATCTAGG + Intergenic
1048250366 8:132861730-132861752 GGCTGAAAATTTTCCAAATTTGG - Intergenic
1050359736 9:4818535-4818557 AGCTGTTAACATGCAAAATTAGG - Intronic
1050423044 9:5487034-5487056 AGCTAAATAATTGCCAAATTGGG + Intergenic
1051036228 9:12749085-12749107 AGCTGATAAATAGCAAAATTGGG - Intergenic
1052615902 9:30841378-30841400 AACAGAAAACTTCCCAAATTTGG - Intergenic
1057158054 9:92861784-92861806 AGCTGAAAACCTCCCAAATCTGG + Intronic
1057318289 9:93986829-93986851 AGATGAAAACTTCCCAAATATGG + Intergenic
1058319721 9:103614022-103614044 AGCAGAAAACTTTCTAAATTTGG - Intergenic
1058641465 9:107089750-107089772 AATTGAAAACTTCCCAAATTTGG + Intergenic
1062700363 9:137898359-137898381 GGCTGAGAACTTGCCAAATTTGG - Intronic
1187284252 X:17887868-17887890 GGTTGAAAACTTCCCAAATTTGG + Intergenic
1187694742 X:21908013-21908035 AGCTGAAAACATGCCACAGTTGG - Intergenic
1187911479 X:24115234-24115256 GGCTGAAAACTTCCCAAATTTGG - Intergenic
1188018949 X:25136008-25136030 GGCTGAAAACTTCCTAAATTTGG - Intergenic
1189131615 X:38504057-38504079 GGCTGAAAACCTCCCAAATTTGG + Intronic
1189169164 X:38892328-38892350 ACCTGACAACTTGTCTAAATAGG - Intergenic
1189428658 X:40927958-40927980 GGCTGAAAACTTCCCAAATTTGG - Intergenic
1189823814 X:44897008-44897030 GGCTGAAAACTTCCCAAATTTGG - Intronic
1189931055 X:46011714-46011736 GGCTGAAAACTCCCCAAATTTGG - Intergenic
1189963330 X:46346050-46346072 GGCTGAACACTTTCCAAATTTGG + Intergenic
1190156122 X:47993984-47994006 ACCTGAAAACTTCCCAAATTTGG + Intronic
1190237939 X:48631856-48631878 ACCTGACAACTTGCCAATAAGGG - Intergenic
1190272492 X:48876995-48877017 GGCTGAAAGCTTCCCAAATTGGG + Intergenic
1190968499 X:55326209-55326231 GGCTAAAAACTTTCCAAATTTGG - Intergenic
1191600380 X:62998632-62998654 AGCTGAAAACTTTTCAAGTTTGG - Intergenic
1191875695 X:65793497-65793519 GGCTGAAAACTTCCCAAATTTGG - Intergenic
1192006093 X:67214094-67214116 GGCTGAAAATTTCCCAAATTTGG + Intergenic
1192548741 X:72036526-72036548 GGCTAAAAACTTCCCAAATTTGG - Intergenic
1192788483 X:74356373-74356395 AGCAGAAAACATTCCAAATTTGG + Intergenic
1193429472 X:81383182-81383204 AGCAGACAACCTACCAAATGGGG - Intergenic
1193489219 X:82127443-82127465 ACTTGACAACTGGCCAAATGTGG + Intergenic
1193511675 X:82409613-82409635 AGCAGAAAACTTTCCAAATGTGG - Intergenic
1193633460 X:83918984-83919006 AGCTGAAAACTTCCCAAATCTGG + Intergenic
1193757767 X:85429515-85429537 AGCTGAAAACATTCCAAATCTGG - Intergenic
1194312746 X:92333669-92333691 AGGTGACAATTTGCCTAATTTGG + Intronic
1194821060 X:98508037-98508059 GGCTGAAAACTTTCAAAATTTGG - Intergenic
1195845787 X:109226576-109226598 GGCTGAAAACTTGCCAGATTTGG + Intergenic
1196225354 X:113159146-113159168 AGCTGAGAACATGCAATATTTGG + Intergenic
1196258241 X:113547688-113547710 GGCTGAAAACTTCCCGAATTTGG - Intergenic
1196663454 X:118292871-118292893 GGTTGAAAACTTCCCAAATTTGG + Intergenic
1197103680 X:122687386-122687408 GGCTGAAAACTTGACAAATTTGG + Intergenic
1197121720 X:122900951-122900973 GGCTGAAAACTTTCCAAATATGG + Intergenic
1198166534 X:134063053-134063075 AGTTGACACCTTGCCCAACTAGG - Intergenic
1198220540 X:134597045-134597067 GGCTGAAAATTTTCCAAATTTGG - Intronic
1198325153 X:135563959-135563981 GGCTGAAAACCGGCCAAATTTGG - Intronic
1198491980 X:137150915-137150937 GGCTGAAAACTTTCCAAATTTGG - Intergenic
1200621013 Y:5447808-5447830 AGGTGACAATTTGCCTAATTTGG + Intronic