ID: 1132422548

View in Genome Browser
Species Human (GRCh38)
Location 15:101684812-101684834
Sequence CCATTGCCTCTAAGCCACCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 82}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132422543_1132422548 7 Left 1132422543 15:101684782-101684804 CCTGCAGAAAGCACTCCTAGCTT 0: 1
1: 0
2: 0
3: 17
4: 137
Right 1132422548 15:101684812-101684834 CCATTGCCTCTAAGCCACCGTGG 0: 1
1: 0
2: 1
3: 7
4: 82
1132422544_1132422548 -8 Left 1132422544 15:101684797-101684819 CCTAGCTTCCATATCCCATTGCC 0: 1
1: 0
2: 1
3: 13
4: 198
Right 1132422548 15:101684812-101684834 CCATTGCCTCTAAGCCACCGTGG 0: 1
1: 0
2: 1
3: 7
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132422548 Original CRISPR CCATTGCCTCTAAGCCACCG TGG Intronic
909929313 1:81477090-81477112 CCATTGCCACTAACCCACCCTGG + Intronic
923064394 1:230504673-230504695 CCCTTACCTCTAAGCCATCTGGG - Intergenic
1066037436 10:31508081-31508103 CAATTGCACCTAAGCCAACGAGG - Intronic
1069798412 10:71067798-71067820 CCATTGCAGCTATGCCACCTCGG + Intergenic
1071987803 10:91070276-91070298 CCATTGCCTAGAAGCAACAGGGG - Intergenic
1078208054 11:9247248-9247270 CCCTTGCCTGCAAGCCACTGGGG + Intronic
1086822481 11:91451212-91451234 CAATTGCCTCTAAGAAACAGGGG + Intergenic
1089792329 11:120953973-120953995 CCTTTGCCTCTAGGCCACAGTGG + Intronic
1092262199 12:6958757-6958779 CCACTGCCTCTCATCCACCCAGG - Intronic
1096482136 12:51949536-51949558 CCCTGGCCTCGAAGCCACAGTGG + Intergenic
1098164708 12:67682468-67682490 CCATGGCCTCTAAGGAACAGTGG + Intergenic
1102445153 12:112996641-112996663 CCCTTACCTGTAAGCCATCGGGG - Intronic
1103479910 12:121244385-121244407 CCATTGGGTCCAAGCCCCCGAGG + Intronic
1113372586 13:109736724-109736746 CCATTTTCTCTAAGTCACTGGGG - Intergenic
1114440036 14:22738887-22738909 CCATTAACTGTAAGCCACTGGGG - Intergenic
1114757806 14:25280238-25280260 CCACTGCATCTCAGCCACCTGGG - Intergenic
1122502061 14:102207398-102207420 ACATGGCCTCAAAGCCACCCTGG + Intronic
1122978108 14:105179255-105179277 CCATCGCCTCGGAGCCACGGGGG + Intronic
1127570515 15:60236808-60236830 CCATTACCTGTAAGCCATCAGGG + Intergenic
1130284651 15:82544814-82544836 CCATTTCTTCTAACCCACAGAGG - Intronic
1132086663 15:98913969-98913991 CTATTGCTTATAAGCCACCCAGG - Intronic
1132422548 15:101684812-101684834 CCATTGCCTCTAAGCCACCGTGG + Intronic
1137825833 16:51494061-51494083 AGATTGCCTCTTAACCACCGTGG - Intergenic
1139818095 16:69693543-69693565 CCAATGCCTCAAAGCCAACAAGG + Exonic
1140773805 16:78230933-78230955 CCATTGCCTCAAAGCAATCATGG - Intronic
1141482830 16:84318298-84318320 CCATTGCCACCAAGCCATCGAGG - Exonic
1146516378 17:33492921-33492943 CCCTGCCCTCTAAGCCACAGAGG + Intronic
1146946537 17:36877489-36877511 CCATTGCCTCCCACCCACTGGGG + Intergenic
1146956777 17:36940596-36940618 CCTTTCCCTCTTAGCCACCACGG + Exonic
1149610962 17:57957412-57957434 CCACTGCCTCTGAGCCCCCAGGG + Intergenic
1150166748 17:62951120-62951142 CCTGTGCCTCCAGGCCACCGAGG - Intergenic
1151486783 17:74406034-74406056 GCAGTGCCTCTGAGCCACCACGG + Intergenic
1152381532 17:79944848-79944870 CCATGGCCCCTGAACCACCGTGG - Intronic
1152457330 17:80423869-80423891 CCCTTGCCTCTGAGCCACCGTGG + Intronic
1156463985 18:37337116-37337138 CCAGTGTCTCTGAGCCACTGAGG - Intronic
1158319192 18:56244699-56244721 CCTTTGCCTCTATTCCACCATGG + Intergenic
1159307047 18:66657191-66657213 CATTTGCCTTTAAGCCACCAAGG - Intergenic
1161043518 19:2122400-2122422 CCGTGGCCTGAAAGCCACCGTGG - Intronic
1164672033 19:30077698-30077720 CCATGGCCTCTCTGCCACCCAGG + Intergenic
926128684 2:10286865-10286887 CCATTGCCCTGAAGCCACCGTGG - Intergenic
927793406 2:26028525-26028547 CCTGTGCCTCCAGGCCACCGAGG - Intergenic
934878785 2:97953704-97953726 TCATTCCCTTTAAGCTACCGTGG + Intronic
937899332 2:127005635-127005657 CCCTTGCTTGTAAGCCACCAGGG + Intergenic
943755777 2:191555576-191555598 CCAATGCCTCTAATTTACCGTGG + Intergenic
1170333982 20:15248180-15248202 ACACTGCCTCTAGGCCACCAGGG + Intronic
1170860116 20:20094900-20094922 CCATTGCCTAAAAGCCCCCTAGG - Intronic
1171535090 20:25880325-25880347 TCATTGAGTCTCAGCCACCGTGG - Intergenic
1173867158 20:46319711-46319733 CCATAGCCTCTTAGCCACTCTGG - Intergenic
1174441868 20:50562123-50562145 CCATCTCCTCTAGGCCACAGAGG + Intronic
1182573055 22:31253347-31253369 CCATGGCCTCTAAGCATCTGAGG + Intronic
1185402527 22:50626312-50626334 CCACAGCCTCTGAGCCACCGAGG + Intronic
950921387 3:16698222-16698244 CCCTTGCTTATAAGCCACTGGGG + Intergenic
951933019 3:27991073-27991095 CCATTGCCTCTGAGGCACATGGG - Intergenic
956497626 3:69845690-69845712 CCATTGCCTCCATGACACTGAGG + Intronic
959249677 3:103926108-103926130 ACAATGCCTCCAAGCCACCGTGG + Intergenic
960043106 3:113170235-113170257 CCATTGTCTCAGAGCCACAGTGG + Intergenic
962750809 3:138433921-138433943 CCATTGACTCTCAGGCACCTCGG + Intergenic
963771283 3:149388828-149388850 CCATAGGCTCTAAGCCATAGAGG + Intergenic
969221147 4:5759482-5759504 CCATAGCCTCTGGGCCACCTGGG - Intronic
985971389 5:3381213-3381235 CCATGGCCTCCAAGCCAGCTAGG - Intergenic
989105080 5:37855338-37855360 CAGTGGCCTCTAAGCCACCTGGG - Intergenic
990663522 5:58046333-58046355 CCTTAGCCTCTAAACCACCAGGG - Intergenic
999442515 5:151613484-151613506 CCATTGTCTAGCAGCCACCGCGG - Intergenic
1002195478 5:177498661-177498683 CCATGGCCTCCAGGCCACAGGGG - Intergenic
1003776106 6:9367200-9367222 CCATTTCCTTTAAGCCACTATGG + Intergenic
1008867263 6:56227864-56227886 CCATTTCCTCTCAGCCAGCCAGG - Intronic
1013140305 6:107327280-107327302 CCATTTCCTCTAAGCAGCAGTGG - Intronic
1019020776 6:168915828-168915850 CCAAGGCTTCTATGCCACCGGGG - Intergenic
1019926745 7:4198015-4198037 CCACTGCATCTAAGGCAGCGAGG + Intronic
1021616494 7:22507544-22507566 CCATTGCCTCTAAGCTGGCCAGG + Intronic
1022521580 7:31011351-31011373 CCATTGCCTCCAAGACACAGTGG - Intergenic
1022671771 7:32462543-32462565 CCAATGCCTCTTTGCCACCCAGG + Intergenic
1022926295 7:35058753-35058775 CCATTGCCTCTAAGCTGGCCAGG + Intergenic
1025286577 7:57667288-57667310 TCATTCACTCTCAGCCACCGTGG - Intergenic
1028375963 7:90146793-90146815 CCATTGCCTCTAAGCTGGCCAGG - Intergenic
1029824302 7:103173443-103173465 CCATTGCCTCTAAGCTGGCCAGG + Intergenic
1037910073 8:22739121-22739143 CCATTGGCTCTCAGCCCCCTGGG - Intronic
1049145638 8:141000189-141000211 CAGTTGCGCCTAAGCCACCGCGG + Intronic
1050876976 9:10651246-10651268 CCACTGCCTCTATGCCATCTGGG + Intergenic
1051342811 9:16127362-16127384 ACATTGCCTCTAACCCAACTTGG - Intergenic
1052823617 9:33159321-33159343 CCATGACCTCTAGGCCCCCGTGG + Intronic
1056974772 9:91242197-91242219 CCATTGCTTCTAAGTCAACATGG + Intronic
1057082281 9:92181765-92181787 CTGTTGCTTCTAAGCCACCAAGG - Intergenic
1060184977 9:121558685-121558707 CCAGTGCCTCTTAGCCAAGGAGG - Intergenic
1060794599 9:126505237-126505259 CCACTGCCTCTGAGCCTCCTAGG - Exonic
1060952683 9:127613411-127613433 CCATTTCCTCCCTGCCACCGTGG - Intronic
1185636160 X:1553699-1553721 CTGTTGTTTCTAAGCCACCGAGG + Intergenic
1191604890 X:63050645-63050667 CCATTGTCTCCCAGCCACAGTGG + Intergenic
1195078656 X:101350771-101350793 CCATGGCCCATAAGCCCCCGAGG + Intronic
1196687122 X:118520651-118520673 CCATTGACTGGCAGCCACCGAGG - Intronic
1198392049 X:136186116-136186138 CCATTGCCACTAATCCATCATGG + Intronic