ID: 1132425065

View in Genome Browser
Species Human (GRCh38)
Location 15:101709266-101709288
Sequence TTCCATAGCCAGTGAGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132425065_1132425073 2 Left 1132425065 15:101709266-101709288 CCCTGCCCTCACTGGCTATGGAA 0: 1
1: 0
2: 0
3: 19
4: 169
Right 1132425073 15:101709291-101709313 AAGGCTGGGAGACATCTGTATGG 0: 1
1: 0
2: 1
3: 12
4: 154
1132425065_1132425074 17 Left 1132425065 15:101709266-101709288 CCCTGCCCTCACTGGCTATGGAA 0: 1
1: 0
2: 0
3: 19
4: 169
Right 1132425074 15:101709306-101709328 CTGTATGGACTGCAGAGTCGCGG 0: 1
1: 0
2: 0
3: 5
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132425065 Original CRISPR TTCCATAGCCAGTGAGGGCA GGG (reversed) Intronic
901241357 1:7695632-7695654 TTCCAGAGCCAGTGAGGTGCTGG + Intronic
901857584 1:12054196-12054218 TCCCACAGCCAGTCAGTGCAGGG - Intergenic
902420678 1:16277432-16277454 TTCCATATCCAGGCTGGGCATGG + Intronic
904377577 1:30091450-30091472 GTCCATAACCTGTCAGGGCATGG + Intergenic
905875115 1:41427399-41427421 TTCCAGAGCCAGTGGGCACAAGG - Intergenic
907522595 1:55033941-55033963 TCCCATAGCCCCAGAGGGCAAGG - Intergenic
907529206 1:55076494-55076516 TTCCTTAGAGAGTGAGGGCCTGG - Intronic
908927953 1:69279321-69279343 TTCCATATCCAGTTAGGTTATGG + Intergenic
909517346 1:76526940-76526962 TTCCATAGCCAGTGAACTCATGG + Intronic
915518828 1:156429652-156429674 TTCCAATGCCTGTGTGGGCAGGG + Intronic
916918287 1:169434924-169434946 TTCCAGAGCCTGTTAAGGCAGGG + Intronic
917177493 1:172253063-172253085 TTTGATAGCCAGTGTTGGCAGGG - Intronic
917517765 1:175722153-175722175 CTCCATGGCCAGGGAGGGCCCGG - Intronic
920087540 1:203428659-203428681 ATCTTTAGCCAGTGACGGCAAGG + Intergenic
921165522 1:212504111-212504133 GCCCAGAGCCAGTGTGGGCAGGG - Intergenic
922819641 1:228475308-228475330 CTCCATGGCCAGTGAGGCCCTGG + Intergenic
922966872 1:229697802-229697824 TTGCATGCCCAGAGAGGGCATGG - Intergenic
1063654147 10:7970432-7970454 TGCTGTAGCCAGTGAGGGGAGGG + Intronic
1065771375 10:29081768-29081790 TTCCCTAGCAACTCAGGGCAGGG + Intergenic
1067551107 10:47237287-47237309 TACTAAAGCCAGTGAGGGCCGGG - Intergenic
1069840964 10:71339179-71339201 TACCACAGCCAGTGAGGGCGAGG - Intronic
1073483673 10:103802912-103802934 TAAAATAGCCAGTGAGGCCAGGG + Intronic
1073947921 10:108773544-108773566 TGGCATAGCCAGAGAGAGCATGG - Intergenic
1074788452 10:116863001-116863023 ATCCATAGCCACTGAGGACATGG - Intronic
1074813915 10:117130809-117130831 TCCCAAAGCCAGGGAGGGAAGGG + Intronic
1078406520 11:11074772-11074794 TCCCAGAGCCAGTCAGGGCGGGG - Intergenic
1078551182 11:12281456-12281478 TCCCATAGCCCCTGAGGGAAGGG + Intronic
1078625908 11:12958027-12958049 TTCCATGGACAGTGGGGGAAGGG - Intergenic
1083628954 11:64086044-64086066 CTCCATAGGGAGGGAGGGCAGGG - Intronic
1084768792 11:71329324-71329346 TTCCACAGACAGGGAGGGCGGGG + Intergenic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG + Intronic
1085943866 11:81241868-81241890 TTACAAAGCCAGTGACTGCAAGG - Intergenic
1090289414 11:125528768-125528790 TGCCATACCCAGAGAGGGCATGG + Intergenic
1090302394 11:125654902-125654924 TTCCATAGGCAGTGAGGGTTTGG - Intronic
1090426225 11:126608660-126608682 TCCCTTAGCCAGGGAGGGCTGGG - Intronic
1090536094 11:127643475-127643497 GACCTTAGCCAGCGAGGGCAAGG - Intergenic
1090872532 11:130761031-130761053 GTCCAGAGGCAGTGAGAGCACGG - Intergenic
1096172056 12:49479434-49479456 CTTCCTAGCCTGTGAGGGCAGGG + Intronic
1096496227 12:52040854-52040876 TCCAATAGCCAGTGAAGGCCTGG + Intronic
1101409195 12:104455378-104455400 TTACAGAGCCAGGGAGGGGAAGG - Intronic
1104228129 12:126857084-126857106 TTCCACAGTCAGTGAGAGCATGG + Intergenic
1104886892 12:132115685-132115707 CCCCAGAGCCAGCGAGGGCACGG - Intronic
1107713832 13:43178971-43178993 TTCCAAAGCAAGTGAGACCATGG + Intergenic
1108162899 13:47661236-47661258 GCCCAAAGCCAGTGGGGGCAAGG - Intergenic
1109704502 13:66072267-66072289 CTCCATTGTCAGTGAGGGCTAGG + Intergenic
1110269034 13:73572388-73572410 TTCCAAAGTCAGTTTGGGCAGGG - Intergenic
1112187897 13:97145532-97145554 TGCCATATGAAGTGAGGGCATGG + Intergenic
1112949525 13:104975453-104975475 TTCTATATACAGTGAGGACACGG + Intergenic
1116163648 14:41304957-41304979 TTCAATATACTGTGAGGGCAAGG - Intergenic
1118370094 14:65130465-65130487 TTCCATGGACAGTGGGGGTAGGG + Intergenic
1120288428 14:82535309-82535331 TTCCATAGACAGTATGAGCATGG + Intergenic
1121935298 14:98012959-98012981 TTCTATGGCCAGTGAGTGCTGGG - Intergenic
1127324424 15:57881575-57881597 TTTCCTAGCCAGTTAGGGCAAGG - Intergenic
1127389305 15:58492271-58492293 TTCCATGGCCATAGAGAGCATGG - Intronic
1127587438 15:60391967-60391989 TTCCATTCCCAGGGAGGGCAGGG + Intronic
1128534967 15:68483516-68483538 TCCCAGAGACAGTGAGGGCCAGG + Intergenic
1130467128 15:84198046-84198068 TTCCATAGCAGGGCAGGGCAGGG + Intergenic
1130497136 15:84475490-84475512 TTCCATAGCAGGGCAGGGCAGGG - Intergenic
1131330908 15:91498507-91498529 TTTCATTGGCAGTGAGGGGAAGG - Intergenic
1132425065 15:101709266-101709288 TTCCATAGCCAGTGAGGGCAGGG - Intronic
1132505700 16:307552-307574 TTCCATGGACAGTGGGGGCAGGG + Intronic
1132946225 16:2532662-2532684 TTCCCAAGACAGTGAGGGCGGGG - Intergenic
1133111410 16:3550231-3550253 TTCCCTAGACAGTGGGGGCTGGG - Intronic
1135524784 16:23205937-23205959 TCCCCCAGCCACTGAGGGCATGG - Intronic
1138200894 16:55087586-55087608 TTTTATAGACAGTGAGTGCAGGG + Intergenic
1140568681 16:76075446-76075468 TTCCATAGCCAGGGAAGAGAAGG + Intergenic
1141287539 16:82686546-82686568 TTCCATAGTCAGTGAGCGACTGG - Intronic
1142102994 16:88285478-88285500 TGCCACAGCCAGCGTGGGCAGGG + Intergenic
1142266776 16:89067600-89067622 TAACACAGCCAGTGAGGACATGG + Intergenic
1143280176 17:5748045-5748067 TTCACCAGCCAGGGAGGGCATGG + Intergenic
1143589153 17:7870380-7870402 TTCCTTACTCAGTGAGAGCAAGG + Intronic
1144514818 17:15910009-15910031 CTACACAGCAAGTGAGGGCATGG + Intergenic
1148123665 17:45226106-45226128 ATCCTTAGCTAGTGAGGGCCAGG + Intronic
1148514781 17:48206335-48206357 TAGCATAGCCAGGGAGGACATGG - Intronic
1149358183 17:55866007-55866029 TTTCACAGGTAGTGAGGGCAGGG - Intergenic
1152087597 17:78230211-78230233 TTTCAGAGACAGGGAGGGCAGGG - Intergenic
1156199538 18:34814059-34814081 GTTCATAGCTAGTGAGGGCAGGG + Intronic
1156644643 18:39146381-39146403 TGCAATAGCCAGTGAAGGAAAGG + Intergenic
1158212731 18:55068833-55068855 TTCAAAAGCCAGTGGGGGCTGGG - Intergenic
1162153958 19:8664327-8664349 GTCCAGAGCCGGTGAGGCCAAGG - Intergenic
1165062570 19:33212092-33212114 GTCCATAGCCAGAGAGAACAGGG + Intronic
1165759704 19:38313759-38313781 TTCAAAAGCCAGTGGGGGCAAGG - Intronic
1167563386 19:50240147-50240169 ATCCATGTCCAGTGAGGGAAGGG + Intronic
1168406123 19:56111558-56111580 TTCCATAGCCAGAGGGGCCGGGG + Intronic
927783095 2:25954899-25954921 CTCCAAAGCCACTGAGGGCTGGG + Intronic
929443685 2:41986316-41986338 TGCCAGAGCCCCTGAGGGCAAGG + Intergenic
933587219 2:84192430-84192452 TTCTATAGACAGGGAGTGCAAGG + Intergenic
934734799 2:96684639-96684661 TTCCCTAGACAGTGAGGACAGGG - Intergenic
937315716 2:120930901-120930923 TTCCCTTGCCAGTGAGGGTGGGG + Intronic
938070661 2:128306643-128306665 GTCCCAAGCCAGTGGGGGCATGG + Intronic
938677661 2:133655088-133655110 TTCCATAGCTAGTGACATCATGG + Intergenic
940750444 2:157621584-157621606 TTCCACAGCAAGTGTGGGAAGGG + Intronic
940776082 2:157885317-157885339 TTCCATAGCTAGTTAAGGCAAGG + Intronic
943044225 2:182839433-182839455 TTCCATAGCACGTGAGGGAAAGG - Intronic
945330205 2:208530327-208530349 TTTCTGAGCCGGTGAGGGCAGGG + Intronic
946335444 2:219032439-219032461 TGCCACAGCGAGTGAGGGCAGGG - Intronic
947023576 2:225711582-225711604 TTCCATAGCCTGGGCTGGCATGG - Intergenic
948348336 2:237318027-237318049 TTCCAGATCCAGAGAGGGCCTGG - Intergenic
948397988 2:237661599-237661621 TTCCATCGACAGTGAGGACAAGG - Intronic
1170122223 20:12923770-12923792 TTGCATAGCTGGTAAGGGCATGG - Intergenic
1170798276 20:19569323-19569345 GTACATCGGCAGTGAGGGCAAGG + Intronic
1173789963 20:45822193-45822215 GCAAATAGCCAGTGAGGGCAAGG + Intergenic
1173893800 20:46534348-46534370 CTCCTGAGCCTGTGAGGGCACGG - Intergenic
1175151903 20:56941384-56941406 TTCTCTAGCCAGTGAGGGATGGG - Intergenic
1175206690 20:57316824-57316846 TTCCCTAGCCAGCAAGGACAAGG - Intergenic
1177821473 21:26035181-26035203 CTCCAGAGCCAGGGAGGTCAAGG + Intronic
1179148547 21:38790273-38790295 TTGGATATCCACTGAGGGCAAGG - Intergenic
1181972338 22:26700529-26700551 TTCCATGGACAGTGAGGGTGGGG - Intergenic
1182149093 22:28016171-28016193 TTCCAGAGTGAGTGAGGCCAGGG - Intronic
1183590789 22:38778198-38778220 TTCAATAGCCACTGAGGGTCAGG - Intronic
1183612487 22:38919341-38919363 TTTCATAGCTAGAGAGGGGAAGG - Intergenic
1184560985 22:45262863-45262885 TTTCCAAGCCTGTGAGGGCAGGG + Intergenic
1184869515 22:47226337-47226359 TTTCTGAGCCTGTGAGGGCAGGG + Intergenic
950181495 3:10916683-10916705 GCCCAAAGTCAGTGAGGGCAGGG + Intronic
954099428 3:48357977-48357999 TTTCTGAGCCTGTGAGGGCAGGG + Intergenic
956496846 3:69836649-69836671 GTCCAGAGCCAGTTAGGACAGGG + Intronic
959156830 3:102677023-102677045 TTTCATTTTCAGTGAGGGCAAGG - Intergenic
959578181 3:107957413-107957435 TTCCAAAGCCAGTGAGAGGGAGG - Intergenic
960447815 3:117769150-117769172 TTCCATAGCATGTGAGTACATGG + Intergenic
960878079 3:122316338-122316360 TTCTATAGCCAGAGAAGTCAAGG + Intergenic
964884358 3:161464477-161464499 TTCCATTGCTGGAGAGGGCAGGG + Intergenic
965851219 3:173027777-173027799 TCCCATAGCCACTGAAGGAAGGG - Intronic
966840054 3:184081155-184081177 TTCCCAAGCCTGTGAGAGCAGGG - Intergenic
971380953 4:26097195-26097217 TTCCAGAGCCCCTGAGGGCCTGG - Intergenic
971599026 4:28569056-28569078 TTCCATAGACCTTTAGGGCACGG + Intergenic
973123447 4:46553347-46553369 TTTCATAGCCAGTTAGGGAAAGG - Intergenic
973840341 4:54854556-54854578 CTTCATAGCCAGTAAGGCCAAGG + Intergenic
974447329 4:62002117-62002139 CTCTCTAGCCAGTGAAGGCAGGG - Intronic
975910190 4:79258358-79258380 TTTCTGAGCCTGTGAGGGCAAGG - Intronic
976734554 4:88296714-88296736 TTTCTGAGCCTGTGAGGGCAAGG + Intergenic
985639114 5:1055008-1055030 GTCCACAGCCAGTGAGTGCTGGG + Intronic
993440404 5:87949988-87950010 TTCCATTGCCAGTTAGGAAAGGG - Intergenic
994017913 5:94989894-94989916 TGTCACAGCCAGAGAGGGCATGG + Intronic
996767222 5:127046626-127046648 TTCCATAGCCAGTTGGCCCAGGG + Exonic
997368647 5:133342007-133342029 TGCCAGAGCCAGTGAGGAGATGG - Intronic
997378714 5:133419742-133419764 GACCATAGCCAGTGTTGGCAAGG - Intronic
1002543033 5:179918951-179918973 TTCCACAGTCAGTGAGAACAGGG + Intronic
1005894272 6:30164318-30164340 TTCCATAGTGAGTGAAGCCAAGG - Intronic
1007484870 6:42174067-42174089 TGCCCTAGAAAGTGAGGGCAGGG - Intronic
1009036066 6:58118097-58118119 TTTCATAACCAGTGAGAGGAAGG + Intergenic
1009211884 6:60871716-60871738 TTTCATAGCCAGTGAGAGGAAGG + Intergenic
1019075678 6:169386477-169386499 TTCCATCGCCAGAAAAGGCATGG + Intergenic
1019466423 7:1192086-1192108 TTCCACGGACAGTGGGGGCAGGG - Intergenic
1020332915 7:7038455-7038477 TTCCCTAGCAAGTAGGGGCAGGG - Intergenic
1020400541 7:7771720-7771742 ATCCAAAGCCACTGAGGGCATGG + Intronic
1023708978 7:42971631-42971653 TGGCATGCCCAGTGAGGGCATGG - Intergenic
1025071320 7:55901655-55901677 TGCCATGCCCAGAGAGGGCATGG + Intronic
1025744157 7:64228150-64228172 TTCCATTTCCTGTGTGGGCAAGG - Intronic
1026735249 7:72945126-72945148 AGCCAGAGCCAGTCAGGGCAAGG + Intronic
1026785591 7:73300055-73300077 AGCCAGAGCCAGTCAGGGCAAGG + Intergenic
1027108476 7:75419881-75419903 AGCCAGAGCCAGTCAGGGCAAGG - Intronic
1028999487 7:97138457-97138479 TTCAAAAGCCAATGAGGGCTGGG - Intronic
1030630001 7:111885391-111885413 TACCAAACCCAGTGAAGGCATGG + Intronic
1030900639 7:115119191-115119213 TTCCATAGCCGGGGTGGGTAGGG - Intergenic
1031532638 7:122894950-122894972 TTCCACAGACGGTGGGGGCAGGG + Intergenic
1032197690 7:129798869-129798891 TCCCATAGGCAGTGGGGGGACGG + Intergenic
1033207597 7:139436316-139436338 TTCCCTAGACAGTGGGGGAAGGG - Intergenic
1033254399 7:139787515-139787537 TTTAATAGCCAGAGAGGGGAAGG + Intronic
1035600210 8:892875-892897 ATCCCTAGCCAGCCAGGGCATGG + Intergenic
1037244485 8:16817295-16817317 TGCCTTAGCCAGGGAGGTCAAGG - Intergenic
1037538838 8:19852865-19852887 TCACATAGCAAGTAAGGGCAGGG - Intergenic
1038053247 8:23833248-23833270 TGCCATAGCCATTGAGCTCAAGG + Intergenic
1039536932 8:38324908-38324930 TGGCATGGCCAGAGAGGGCATGG + Intronic
1040598630 8:48863470-48863492 TTCCAGGGCCACTTAGGGCAGGG + Intergenic
1041357365 8:57014563-57014585 TTTCTGAGCCAGCGAGGGCAGGG + Intergenic
1045962917 8:107989626-107989648 TGCTCTAGCCAGTTAGGGCAGGG - Intronic
1046664484 8:116985715-116985737 TTCCAGAGTAAGTGAGGACATGG - Intronic
1046794818 8:118359447-118359469 TTCCAAACCCAGTTAGGACAGGG + Intronic
1049565368 8:143335215-143335237 TCCCAGAGCCTCTGAGGGCAGGG + Intronic
1051541849 9:18228733-18228755 TTCCATTTCCTGTGAGAGCAAGG - Intergenic
1051944740 9:22554534-22554556 TAGCATACCCAGGGAGGGCATGG - Intergenic
1057804287 9:98209521-98209543 TACCACAGCCAGTAAGCGCAGGG + Intronic
1058272996 9:102998585-102998607 TTGCATAGTCAGTAGGGGCAAGG + Intronic
1058704103 9:107624594-107624616 TTTCATAGCCAGGGAGAGGAGGG + Intergenic
1059875273 9:118627846-118627868 TTGTATAGCCAGTGGTGGCATGG - Intergenic
1060245740 9:121944758-121944780 TCACATAGCCAGTGTGGGCCAGG - Intronic
1061857343 9:133449521-133449543 TCCCAGAGACAGTGGGGGCAGGG - Intronic
1062704017 9:137924853-137924875 TTTCATCCCCTGTGAGGGCAGGG - Intronic
1186217793 X:7318452-7318474 TTCCATAGGCAGTGTGTGCTCGG + Intronic
1187195264 X:17077604-17077626 ATCCATAACAAGTGTGGGCAAGG - Intronic
1187208527 X:17206259-17206281 TTCCAGAATCAGTGAGGTCATGG - Intergenic
1187396825 X:18926700-18926722 TTCCAAAGCCAGTCATTGCATGG - Intronic
1193516510 X:82472247-82472269 CTCCAGAGCCTGTCAGGGCATGG - Intergenic
1195658710 X:107357679-107357701 TTCTTTAGCAAGTGTGGGCAGGG - Intergenic
1195751688 X:108165731-108165753 TTCCATTACCAGTGAGGTAAGGG - Intronic
1197239031 X:124103574-124103596 TTCCATAGACTTTGGGGGCAGGG - Intronic
1200859561 Y:7975987-7976009 TTTAATAACCACTGAGGGCATGG - Intergenic
1201256694 Y:12114456-12114478 TTCCATGGGCAGTGAGCCCATGG - Intergenic