ID: 1132426200

View in Genome Browser
Species Human (GRCh38)
Location 15:101719510-101719532
Sequence CATGGTATGAATGCTTTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 75}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132426195_1132426200 -2 Left 1132426195 15:101719489-101719511 CCATAAACCATTCCTCTCTTCCA 0: 1
1: 0
2: 1
3: 33
4: 426
Right 1132426200 15:101719510-101719532 CATGGTATGAATGCTTTAGCTGG 0: 1
1: 0
2: 0
3: 6
4: 75
1132426197_1132426200 -9 Left 1132426197 15:101719496-101719518 CCATTCCTCTCTTCCATGGTATG 0: 1
1: 0
2: 1
3: 26
4: 325
Right 1132426200 15:101719510-101719532 CATGGTATGAATGCTTTAGCTGG 0: 1
1: 0
2: 0
3: 6
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132426200 Original CRISPR CATGGTATGAATGCTTTAGC TGG Intronic
904013721 1:27405036-27405058 CACGGTGGGAATGCTTAAGCAGG + Exonic
905095733 1:35469006-35469028 CATGGTATGAATTCAATAGGTGG + Intronic
907196120 1:52688334-52688356 GATGGGAAGATTGCTTTAGCCGG - Intronic
909093724 1:71260159-71260181 CTTGGTATGAATTCTTTTTCAGG + Intergenic
909944533 1:81648984-81649006 CATGGTTTTAATGCCTGAGCTGG - Intronic
916741336 1:167649615-167649637 CATGGTATGAGGCCTTTAGGAGG + Intronic
917565543 1:176208364-176208386 CATGGGAGGATTGCTTGAGCTGG + Intergenic
919079531 1:192853341-192853363 AATGGAATCAATGCTTGAGCTGG - Intergenic
1070611559 10:77936835-77936857 CATTGTAGGAATGTTTTAACAGG - Intergenic
1087597304 11:100270482-100270504 CATGGCATGCATGCTTTATTTGG - Intronic
1091073382 11:132590518-132590540 CATGTTATGAATGCTTTCCATGG + Intronic
1096715037 12:53486261-53486283 AATGGTATGAAGGCCTCAGCTGG + Intronic
1100670272 12:96803911-96803933 AATATTTTGAATGCTTTAGCTGG - Intronic
1103177011 12:118872984-118873006 CATGTGATAAATGCTTTAGTGGG + Intergenic
1104102749 12:125629637-125629659 CCTTGTCTGATTGCTTTAGCTGG + Intronic
1105277850 13:18946657-18946679 TATGGTATGTATGTTGTAGCAGG - Intergenic
1112935969 13:104798964-104798986 CACTGTATGAATGGTTTATCGGG + Intergenic
1119206149 14:72795059-72795081 CATGGTATGAGGGATTTTGCAGG - Intronic
1120337625 14:83178440-83178462 AATGGAATGAATTCTTTAGTTGG - Intergenic
1120442222 14:84556320-84556342 CATGATATGAATGCTTATGGTGG + Intergenic
1120884510 14:89441360-89441382 AATGGTATGAAAAATTTAGCAGG - Intronic
1122693436 14:103542002-103542024 CACGGAATGTGTGCTTTAGCCGG - Intergenic
1124352060 15:28963117-28963139 CCTGGTGTGAATTTTTTAGCTGG + Intronic
1125101570 15:35919327-35919349 CCTGGTTTTAATGCTTTAGTTGG + Intergenic
1125160551 15:36638836-36638858 CATCATATAAATGCTTAAGCAGG + Intronic
1130776627 15:86990891-86990913 AATGGCATGAATGCTTTATCTGG + Intronic
1132426200 15:101719510-101719532 CATGGTATGAATGCTTTAGCTGG + Intronic
1143501388 17:7341565-7341587 CATGGTCTGGATGCTCTACCTGG - Intronic
1144734011 17:17544887-17544909 CTTGGTAAGAATGCTGCAGCTGG - Intronic
1145117058 17:20220676-20220698 CCTTGTCTGATTGCTTTAGCTGG + Intronic
1153690602 18:7589459-7589481 CATGGTAGGAATGCTGGAGCTGG + Intronic
1159449603 18:68583534-68583556 CAGGGTATGAAGGCTTTTGGTGG - Intergenic
1164867005 19:31612771-31612793 GATGGTGTGAATTCTTAAGCTGG - Intergenic
932025634 2:68129392-68129414 CATATTATGAATGTTTTAGTTGG + Intronic
933991814 2:87639360-87639382 CGCGGTATGAATGCTTTAGATGG + Intergenic
936302033 2:111311458-111311480 CGCGGTATGAATGCTTTAGATGG - Intergenic
942638865 2:178039107-178039129 CATGGAATCAATGTTTTTGCAGG + Intronic
1174196703 20:48777336-48777358 GAGGGTATGAAGGCTTTCGCTGG + Intronic
1174963636 20:55185828-55185850 CCTGGTGGCAATGCTTTAGCAGG - Intergenic
1185099341 22:48829255-48829277 CATGGGATGAATGTTTGAACTGG + Intronic
950464627 3:13145927-13145949 CATGGTATGGGTGCATGAGCAGG + Intergenic
952763242 3:36934040-36934062 CATGGTAGGCATGCTCTAGATGG + Intronic
953147537 3:40292158-40292180 CACAGTATGAATGTTTTTGCAGG - Intergenic
953282897 3:41575838-41575860 CATGTTATTTAGGCTTTAGCAGG + Intronic
954095950 3:48328115-48328137 CATTGTATGAATCCTTTCTCTGG + Intronic
959493865 3:107025997-107026019 CATGGCCTAAATACTTTAGCAGG - Intergenic
964524702 3:157606272-157606294 GATGGTGTAAATGATTTAGCAGG - Intronic
966564351 3:181359897-181359919 CATTGTACCCATGCTTTAGCAGG - Intergenic
971513217 4:27453847-27453869 AATGGTAAAAATGTTTTAGCAGG - Intergenic
971774673 4:30947032-30947054 CAAGGAATGAGTTCTTTAGCTGG - Intronic
974884667 4:67803841-67803863 CATAGTATCAATGCCATAGCAGG - Intergenic
982487581 4:155985680-155985702 AATGGTTTGCATGCTTTTGCTGG + Intergenic
984997512 4:185450065-185450087 GATGTTAAGAATGCTTTAGTAGG - Intronic
991174800 5:63674971-63674993 CATGGAATACCTGCTTTAGCGGG + Intergenic
996666291 5:126064209-126064231 CATGTTCTGTTTGCTTTAGCGGG - Intergenic
996747266 5:126855948-126855970 CATGCTATTAATGCTATATCTGG - Intergenic
1001736060 5:174002968-174002990 CATGTTATGAATTTTTTGGCTGG + Intronic
1003588806 6:7419225-7419247 CATGGTATGTTTGCATTAGGAGG + Intergenic
1009469395 6:64013373-64013395 CATTATATGAATGCTTTTACCGG - Intronic
1010668570 6:78658446-78658468 CATAGTATGAATGCTTAATAGGG - Intergenic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1020365325 7:7374491-7374513 CATGCTATGAAAGCTTTTGAGGG + Intronic
1021927821 7:25550303-25550325 CATGGTATGTCTGCAATAGCAGG + Intergenic
1031145386 7:117992010-117992032 CATGGAATGAATACTTCAGGTGG - Intergenic
1036477322 8:9104943-9104965 CAGAGTATGAAAGCTTTAGCAGG + Intronic
1036572138 8:9989684-9989706 GATGGGAGGATTGCTTTAGCTGG + Intergenic
1037279413 8:17220252-17220274 CAAGGTATCAATGCTGTAGATGG + Exonic
1040589285 8:48774768-48774790 GATGGTCTGAAAGCTATAGCAGG - Intergenic
1043155645 8:76775829-76775851 CATGGCCTGAAAGCTTTAGGTGG + Intronic
1043238098 8:77894738-77894760 CATGCAATGAATGCTTTAGTAGG + Intergenic
1044053681 8:87542011-87542033 GATGGTATGAATGCATGTGCTGG - Intronic
1055838016 9:80467871-80467893 CATGGCATGAATCACTTAGCTGG + Intergenic
1060750007 9:126162786-126162808 CATGCTATGCAGGCTTTGGCTGG + Intergenic
1187282988 X:17876196-17876218 CTTGGTATGCTTGATTTAGCTGG + Intergenic
1188257017 X:27975309-27975331 CATGGTAGGAATGCTCTTCCTGG + Intergenic
1188516850 X:30997020-30997042 CATTTTATGAATGCTTTTGACGG + Intergenic
1189739770 X:44105856-44105878 CATATTATGAATACTTAAGCAGG - Intergenic
1193661265 X:84261630-84261652 AATGATATAAAGGCTTTAGCAGG - Intergenic
1195414168 X:104602293-104602315 CATGGTATGAGTGCAGTATCTGG - Intronic
1195883940 X:109620911-109620933 CATGGTATATTCGCTTTAGCTGG + Intergenic
1196001196 X:110788113-110788135 CAAGGTTTGAGTTCTTTAGCTGG - Intronic
1196656598 X:118224917-118224939 CAGTGTATGAAAGCTTAAGCCGG + Intergenic