ID: 1132432402

View in Genome Browser
Species Human (GRCh38)
Location 15:101772458-101772480
Sequence TGGCCTTATGGACCTCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132432402_1132432407 -3 Left 1132432402 15:101772458-101772480 CCTCCAGGAGGTCCATAAGGCCA No data
Right 1132432407 15:101772478-101772500 CCACTCTGGAGCCAAAATAATGG No data
1132432402_1132432408 -2 Left 1132432402 15:101772458-101772480 CCTCCAGGAGGTCCATAAGGCCA No data
Right 1132432408 15:101772479-101772501 CACTCTGGAGCCAAAATAATGGG No data
1132432402_1132432410 10 Left 1132432402 15:101772458-101772480 CCTCCAGGAGGTCCATAAGGCCA No data
Right 1132432410 15:101772491-101772513 AAAATAATGGGTTCACATCTCGG 0: 1
1: 7
2: 4
3: 22
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132432402 Original CRISPR TGGCCTTATGGACCTCCTGG AGG (reversed) Intergenic
No off target data available for this crispr