ID: 1132432473

View in Genome Browser
Species Human (GRCh38)
Location 15:101772814-101772836
Sequence AGGCATACACAGAACAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 1, 2: 4, 3: 29, 4: 308}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132432470_1132432473 7 Left 1132432470 15:101772784-101772806 CCTGAGGGCAAGAGGTGAGCATT No data
Right 1132432473 15:101772814-101772836 AGGCATACACAGAACAAACAGGG 0: 1
1: 1
2: 4
3: 29
4: 308
1132432466_1132432473 29 Left 1132432466 15:101772762-101772784 CCAGCGGAGTTGAAAAATGCAAC No data
Right 1132432473 15:101772814-101772836 AGGCATACACAGAACAAACAGGG 0: 1
1: 1
2: 4
3: 29
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132432473 Original CRISPR AGGCATACACAGAACAAACA GGG Intergenic
900761882 1:4478104-4478126 AGGCCTCCACAGAAGCAACATGG - Intergenic
901237435 1:7674956-7674978 AGGGAGACAGAAAACAAACAAGG + Intronic
901561759 1:10077312-10077334 AGACACACACAGAACGAAGATGG - Intronic
902476647 1:16692054-16692076 GGGCAGGCACAGAACAAACCAGG - Intergenic
902857258 1:19217064-19217086 AGGAATACACACAAAAAACAAGG + Exonic
906592240 1:47036210-47036232 AGACAGACACAGTACAATCATGG - Intronic
907579491 1:55558728-55558750 AGGCAGGCATAGAACAAGCAAGG - Intergenic
909890084 1:80994472-80994494 AGGCATACACAAAAGAAAAGAGG - Intergenic
910230414 1:84981020-84981042 AGACATACAAATCACAAACAGGG + Intronic
911175413 1:94812709-94812731 AGGCAGAAACAAAAGAAACAAGG + Intergenic
911231392 1:95365113-95365135 AGCCATACACAGAATAAAACTGG + Intergenic
911347097 1:96710302-96710324 GGGCTCACACAGAACAAATATGG + Intergenic
911423036 1:97669892-97669914 AGACATACACAGAAGAAAAGAGG - Intronic
913080251 1:115378124-115378146 AGCCATAGACAGAAATAACATGG + Intergenic
914342641 1:146773468-146773490 AAGCATAAACAGAACAAATGAGG + Intergenic
916642594 1:166746687-166746709 AGATATACACAGACCAAAAATGG + Intergenic
917225313 1:172775382-172775404 AGGCATACAATTAAAAAACAAGG + Intergenic
917599846 1:176563006-176563028 AGACATGCACATAACAAATAAGG - Intronic
918735247 1:188053682-188053704 TGGCAAAAACAGAACAAAGAAGG - Intergenic
920179185 1:204122137-204122159 GAGCATACCCAGAACACACAAGG - Intronic
922616194 1:226962583-226962605 AGCCATCCACAGAACAGACGTGG - Intronic
923065665 1:230515062-230515084 AGGCATATAAAGAACAAAAGTGG + Intergenic
924497358 1:244603078-244603100 AGGCAGACACACTACAACCAGGG - Intronic
1063953559 10:11246167-11246189 ACGCATCCACATAAAAAACAGGG - Intronic
1064641464 10:17419648-17419670 AGTCATAGACAGAAGAAAAAAGG + Intronic
1065917507 10:30365595-30365617 AGGCATATACAGAACAAACGGGG + Intronic
1066019433 10:31283331-31283353 AGGGACACACAGAACAAAAAGGG - Intergenic
1068679155 10:59800259-59800281 AGGCACACAGAGAGCACACATGG - Intronic
1069593438 10:69655773-69655795 ACGCGTACACTGCACAAACAGGG - Intergenic
1070425214 10:76280552-76280574 AAGCATACCCCAAACAAACAGGG - Intronic
1070930765 10:80259046-80259068 AAACATCCACAGGACAAACAAGG + Intergenic
1072735015 10:97873402-97873424 AGGCTGACACAGAAGAAAGAGGG - Intronic
1073877655 10:107944212-107944234 AGGCTTAAACAGAACAAAATGGG + Intergenic
1073899795 10:108206601-108206623 AGGCCCACATAGAACAAAAAGGG - Intergenic
1074528972 10:114284019-114284041 AGGGTTACAGAAAACAAACAAGG - Intronic
1075215986 10:120535495-120535517 AGACACACACACAAAAAACAAGG - Intronic
1076286774 10:129307106-129307128 AGTCATGCACACAAGAAACAAGG + Intergenic
1076758447 10:132587591-132587613 CGGCATACAAACAACAAAGAGGG - Intronic
1078916958 11:15787384-15787406 AGGAATACAGAAAACCAACAAGG + Intergenic
1080298855 11:30761332-30761354 AGCCATTCACAGATAAAACAAGG + Intergenic
1081347900 11:42012828-42012850 AGGAACACAGAGAACAATCAGGG + Intergenic
1083823424 11:65184813-65184835 AGGGAGTCACTGAACAAACAGGG - Intronic
1084290581 11:68163413-68163435 AGGCATATACAGAAGAATTATGG + Intronic
1084955654 11:72689912-72689934 AGGCACACACAGAAGAAGCAAGG + Intronic
1085843343 11:80038883-80038905 TGGAACACACAGAACAAACAGGG - Intergenic
1086762358 11:90648228-90648250 AGCCATACACAAAATAAGCAGGG - Intergenic
1087296653 11:96384993-96385015 AGGGATACATAGAAAAATCATGG + Intronic
1088047911 11:105475869-105475891 AGGAAGACACAGCACAAACGTGG - Intergenic
1088474376 11:110220110-110220132 TGGCACACACTCAACAAACATGG + Intronic
1088638064 11:111843790-111843812 AGGCAGACACAGAAACAAAAAGG + Intronic
1088752602 11:112857065-112857087 AGACAGACGCAGAACAACCAAGG + Intergenic
1089592839 11:119555713-119555735 AGGCAGGCACAGAACCAGCAGGG - Intergenic
1090086946 11:123658597-123658619 AGCAGTAGACAGAACAAACAAGG - Intergenic
1090864344 11:130684354-130684376 AGGCAGAGACAAAACAAAAAAGG - Intronic
1091272166 11:134324033-134324055 TGGCAAAGAAAGAACAAACATGG - Intergenic
1091472349 12:740129-740151 ACACACACACAGAACAAACTAGG - Intergenic
1091908811 12:4212190-4212212 AGCCAAATACAGAATAAACATGG - Intergenic
1093202011 12:16199176-16199198 AGGCATACAGTGAACAAGCAGGG - Intronic
1093587246 12:20854261-20854283 ATTCATATACAGAACAACCAGGG - Intronic
1093802690 12:23392656-23392678 AGGCAGAGACAAAACAAAAAAGG + Intergenic
1095293022 12:40497966-40497988 AGGCATACTGAGATCAAACTAGG + Intronic
1097201000 12:57278534-57278556 AGTCATACACATAAAAAACACGG + Intronic
1097219844 12:57442371-57442393 AGGCAAACACAAGACCAACAGGG - Intronic
1097454354 12:59778268-59778290 AGTCATAAACATAACAAAAATGG - Intronic
1099056469 12:77847769-77847791 ACACATGCAGAGAACAAACACGG - Intronic
1099084640 12:78230378-78230400 ATGCATTCAAAGAAGAAACAGGG + Intergenic
1100871909 12:98918366-98918388 ATGAATACACAGAAGATACAAGG + Intronic
1101625275 12:106434672-106434694 AGGTATACACAGAATAACTACGG - Intronic
1101808705 12:108089508-108089530 AGGCAAATAAAGAAAAAACAAGG - Intergenic
1101883715 12:108643543-108643565 TGGCATACACAGAAAAAAGTTGG + Intergenic
1102043597 12:109816130-109816152 TGGAAGCCACAGAACAAACAAGG - Intronic
1102648142 12:114417154-114417176 AGGCACACACATCACAACCAAGG + Intergenic
1104868906 12:131980008-131980030 ATGCATACAGAAAACCAACACGG - Intronic
1107183148 13:37485506-37485528 TTGCACACACAGAACACACAAGG - Intergenic
1110197024 13:72801488-72801510 ATGCATACACAGACCTTACATGG + Intronic
1110338523 13:74361852-74361874 TGGCATAGACACAACACACAAGG - Intergenic
1111800257 13:92972538-92972560 AAGCATACACAGTACAACCTGGG - Intergenic
1112716636 13:102193572-102193594 AGGCATGCACCTAACACACATGG + Intronic
1114547698 14:23514408-23514430 TGGCATATACAGACCAGACAAGG - Intergenic
1115087001 14:29529536-29529558 AGGTAAACACAAAACGAACATGG + Intergenic
1116050120 14:39792122-39792144 AGGAATACTCAGAAGAGACAGGG - Intergenic
1116616963 14:47152246-47152268 AGGTATACAAAGAAAAACCATGG - Intronic
1116886028 14:50222703-50222725 GGGCAGAAGCAGAACAAACAAGG + Intronic
1118817567 14:69323947-69323969 ATGCATACGCAGAAACAACAGGG + Intronic
1118889359 14:69895011-69895033 AGGCATGCACAGAGCAATAAAGG - Intronic
1119040839 14:71273007-71273029 AAAAATACACAGAACACACACGG - Intergenic
1120001493 14:79308232-79308254 AGACATACAAAGGACAAAGATGG - Intronic
1120689917 14:87581042-87581064 ATGCAGACAAAGAAGAAACAAGG + Intergenic
1121064478 14:90949641-90949663 TGGCATAGTCAAAACAAACAGGG + Intronic
1121907168 14:97757124-97757146 AGTCATACTCAGAACACACCAGG - Intronic
1123473553 15:20571581-20571603 GGGCATACACAGAAGAAATGGGG - Intergenic
1123644456 15:22428772-22428794 GGGCATACACAGAAGAAATGGGG + Intergenic
1123665772 15:22608680-22608702 GGGCATACACAGAAGAAATGGGG + Intergenic
1123733851 15:23166592-23166614 GGGCATACACAGAAGAAATGGGG - Intergenic
1123751988 15:23363973-23363995 GGGCATACACAGAAGAAATGGGG - Intronic
1124122969 15:26907861-26907883 AGGTATACAAATAACACACATGG + Intronic
1124284354 15:28387897-28387919 GGGCATACACAGAACAAATGGGG - Intronic
1124298343 15:28523717-28523739 GGGCATACACAGAACAAATGGGG + Intronic
1124319594 15:28703093-28703115 GGGCATACACAGAACAAATGGGG + Intronic
1124482917 15:30092337-30092359 GGGCATACACAGAAGAAATGGGG - Intronic
1124489370 15:30144408-30144430 GGGCATACACAGAAGAAATGGGG - Intronic
1124520659 15:30404881-30404903 GGGCATACACAGAAGAAATGGGG + Intronic
1124537998 15:30561338-30561360 GGGCATACACAGAAGAAATGGGG - Intronic
1124544458 15:30613399-30613421 GGGCATACACAGAAGAAATGGGG - Intronic
1124564420 15:30800834-30800856 GGGCATACACGGAGCAAACGGGG - Intergenic
1124754159 15:32393919-32393941 GGGCATACACAGAAGAAATGGGG + Intronic
1124760651 15:32446247-32446269 GGGCATACACAGAAGAAATGGGG + Intronic
1124777980 15:32602815-32602837 GGGCATACACAGAAGAAATGGGG - Intronic
1125259054 15:37801368-37801390 AGGCATACTCAGAGCCCACAGGG + Intergenic
1125347384 15:38732094-38732116 AGGCAAACAAATAAAAAACAAGG - Intergenic
1126440120 15:48678609-48678631 AAGCAAACACAACACAAACAAGG + Intergenic
1126657686 15:50996949-50996971 AGGCTTATACAGAACAACTATGG + Intronic
1127882377 15:63169681-63169703 TGGCATACCCAGAACAAAACAGG - Intergenic
1128113606 15:65092017-65092039 AGGCCTACACACAACAAGCTTGG - Intergenic
1128651660 15:69419610-69419632 AGGCATACAGAGTACAGACCAGG - Intronic
1128907259 15:71478171-71478193 TGGCATTCACAGAACCAAAACGG - Intronic
1129030268 15:72612529-72612551 GGGCATACACAGAACAAACAGGG - Intergenic
1129038505 15:72665237-72665259 GGGCATAGACAGAACAAATGAGG - Intronic
1129211384 15:74071993-74072015 GGGCATAGACAGAACAAATGAGG + Intronic
1129399017 15:75269091-75269113 GGGCATAGACAGAACAAATGAGG - Intronic
1129402625 15:75293367-75293389 GGGCATAGACAGAACAAATGAGG - Intronic
1129476158 15:75785792-75785814 GGGCATACACAGAACAAATGAGG - Intergenic
1129552272 15:76465826-76465848 AGGAATACACAGCAGAAAAAAGG - Intronic
1130436958 15:83910078-83910100 AGGAAAAAACAGAAGAAACATGG - Intronic
1130524626 15:84693940-84693962 AAGTATACATAGAACAAATATGG + Intronic
1130918998 15:88328448-88328470 AGGCATAAATAAAACAAATAAGG + Intergenic
1131188485 15:90294609-90294631 GGGCATACACAGAACAACTGGGG - Intronic
1131282340 15:91032170-91032192 GGGGATACACAGGACAAACGCGG + Intergenic
1131671831 15:94627947-94627969 GGGCATGCACAGAAGAAAGAGGG - Intergenic
1131976002 15:97946575-97946597 AGGCACAGACTGAAGAAACAAGG + Intergenic
1132184499 15:99791845-99791867 GGGCATACACAGAACGAACGGGG - Intergenic
1132420486 15:101661933-101661955 AGACAGTCACAGAACAAATAAGG - Intronic
1132432473 15:101772814-101772836 AGGCATACACAGAACAAACAGGG + Intergenic
1134108004 16:11497710-11497732 AGCCATACACAGAACCAACTGGG - Intronic
1139991342 16:70941860-70941882 AAGCATAAACAGAACAAATGAGG - Intronic
1140881745 16:79204723-79204745 TGGCCTTCCCAGAACAAACATGG + Intronic
1142170269 16:88618308-88618330 AGGCACTCACAGAACAAGCCAGG + Intronic
1148774224 17:50086386-50086408 ATGTATAGTCAGAACAAACACGG + Intronic
1149137501 17:53386675-53386697 ACACACACACAGAACAAAAATGG + Intergenic
1151057824 17:71053990-71054012 AGGGACACAGAGATCAAACAGGG + Intergenic
1151373433 17:73665589-73665611 AGACAGAGACAGAACACACATGG - Intergenic
1153063389 18:1017642-1017664 AGGCATACAAAGAACGATGAAGG - Intergenic
1153066861 18:1055661-1055683 AGACATACAAATGACAAACAGGG - Intergenic
1154250616 18:12741299-12741321 AGGCCTGCAAAGAACAAAAAAGG - Intergenic
1154931096 18:20997256-20997278 AGACATACACAGAAAAAACAAGG + Intronic
1155095745 18:22554477-22554499 ACGCACACACAGAGCAAATATGG - Intergenic
1156345231 18:36251256-36251278 AGGAATGCAAAGAAGAAACATGG + Exonic
1157627484 18:49062611-49062633 TGCCATGCACAGAACACACACGG + Intronic
1158163399 18:54511561-54511583 AGGCATACAAATGGCAAACAGGG + Intergenic
1164454824 19:28398318-28398340 AGGAAACAACAGAACAAACAAGG + Intergenic
1164466812 19:28494115-28494137 AGGCAGAGACGGAACAAAGAAGG + Intergenic
1164875674 19:31685093-31685115 TGGAATAAACAGAACAAATATGG - Intergenic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
1168351323 19:55677795-55677817 AGGAATCCACAGCAGAAACAAGG - Intronic
1168554926 19:57329969-57329991 ATGCATACACAGAAAAATAAAGG - Exonic
1168612549 19:57813030-57813052 AAACATCCACAGGACAAACAAGG + Intronic
1202710668 1_KI270714v1_random:17895-17917 GGGCAGGCACAGAACAAACCAGG - Intergenic
925476791 2:4225978-4226000 AGGCGTAGACAAAACAGACAGGG - Intergenic
926291448 2:11534375-11534397 AGGCACACACAAAACCCACAAGG + Intronic
926930926 2:18040178-18040200 AGGCAGAAACAGCACAACCATGG - Intronic
927313209 2:21653258-21653280 AGGCATAGACAAAAGACACAGGG - Intergenic
929288921 2:40166845-40166867 AGACTTACACAGAACAAGAATGG + Intronic
930428169 2:51237870-51237892 AGCCAAACACAGCACCAACAAGG - Intergenic
934131362 2:88952383-88952405 AGGCATATAGAGAGGAAACAGGG + Intergenic
934676330 2:96252460-96252482 AGCCAGACCCAGAGCAAACAAGG + Exonic
935334111 2:101999190-101999212 AGACAAAGACAGAAGAAACAAGG - Intronic
935735250 2:106101454-106101476 AGGCATACACTCAAAAAAGATGG + Intronic
935873261 2:107475329-107475351 AGGCATACAATGTATAAACAGGG + Intergenic
936438537 2:112529728-112529750 GGGCATAAAAAGAACAAAAAGGG - Exonic
936548102 2:113410484-113410506 AGCCATATACAGAAAAAATAAGG + Intergenic
936606132 2:113956496-113956518 ATACTTAAACAGAACAAACAAGG - Intronic
936642285 2:114328061-114328083 AGCAATACAAAGAACCAACAAGG - Intergenic
937091276 2:119208025-119208047 AGGCATACAGAGAGGAAATATGG - Intergenic
938756801 2:134388067-134388089 AGGGAGGCACAGAACTAACATGG + Intronic
938795390 2:134714670-134714692 AGGCTTACACAGAATCAAAAGGG + Intronic
938809303 2:134837562-134837584 GGGTAAACACAGAACAATCAAGG + Intergenic
939121812 2:138126485-138126507 GGGCTGACACAGAACAAGCATGG - Intergenic
940382835 2:153035743-153035765 AGGAAGATACAGAACATACAAGG - Intergenic
940801030 2:158132643-158132665 GGTAATACACAGAACATACAAGG + Intronic
940982564 2:160019944-160019966 AAGTACACACAGAAAAAACATGG - Intronic
942850580 2:180479981-180480003 AGGCATACATATAACAAAAAAGG + Intergenic
947036334 2:225861729-225861751 AGATATACAGAGGACAAACAAGG + Intergenic
948009606 2:234640737-234640759 AGGCATACAAAGAAAAGAGAGGG + Intergenic
948047364 2:234954054-234954076 ACGCATAAACTGAACAAACCTGG + Intronic
1169247955 20:4038688-4038710 ATGCATACAGTGAACAAACAAGG + Intergenic
1169504707 20:6196860-6196882 ACACATACACAAAACAAAAATGG - Intergenic
1169887916 20:10422094-10422116 ATGTATACACAGAACACAGATGG - Intronic
1174123894 20:48288560-48288582 AAACAAACAAAGAACAAACAAGG + Intergenic
1174776559 20:53348144-53348166 AGGCATACATACAAAAAACATGG + Intronic
1175002837 20:55648325-55648347 AGGCATACAGAGGAGAGACATGG + Intergenic
1175345842 20:58274465-58274487 AAGCAGACAAAGAACAAAAAGGG + Intergenic
1176973888 21:15296421-15296443 ATGCTTACACATAACAAGCATGG - Intergenic
1177026997 21:15932707-15932729 AGGCAAAGACAAAACAAAAAAGG + Intergenic
1177467815 21:21512117-21512139 AAGCATAAACAAAGCAAACATGG - Intronic
1178096874 21:29224457-29224479 AGGCAGAGAAAGCACAAACACGG + Intronic
1178171267 21:30042449-30042471 AGGGAAACAGAGAGCAAACAAGG - Intergenic
1179026065 21:37679565-37679587 AGGCAAACACAGAAAGAACAGGG + Intronic
1179353292 21:40633830-40633852 AACCATACACAGAAAACACAAGG + Intronic
1179843382 21:44092455-44092477 AGCCATAAACAGAAAAAGCAAGG - Intronic
1181170949 22:21009685-21009707 AGAAATACACAGAAGAAAAACGG + Intergenic
1182509390 22:30808173-30808195 AGGTATACACAGAAGACACAGGG + Intronic
1184981339 22:48097730-48097752 AGGCGTTCACTAAACAAACAGGG - Intergenic
949178760 3:1101012-1101034 AAGCATACACAACTCAAACAAGG - Intronic
950122827 3:10493152-10493174 AGACAGACAGACAACAAACAAGG + Intronic
950258239 3:11523399-11523421 AGGCCTAGACAGAAGAAACAGGG + Intronic
950897507 3:16467074-16467096 AGAGATACACAAAACAAAAAGGG + Intronic
952621368 3:35347171-35347193 AGGAATACACAAAAGAAACAAGG - Intergenic
953221352 3:40974467-40974489 AGGGATAAATAGAACAGACATGG - Intergenic
955113737 3:55975799-55975821 AGGCATGCTCAGAAGAAACGGGG - Intronic
958615577 3:96490046-96490068 CGGCAGAGACAGAACAAAAAAGG - Intergenic
958812037 3:98871735-98871757 AGGAAAAGACACAACAAACAAGG - Intronic
958991799 3:100854693-100854715 TTGCATTCACAGAACATACATGG + Intronic
959315356 3:104798701-104798723 AGGCATACAGAAGACAAAGAAGG - Intergenic
960759756 3:121060433-121060455 TGGCAGAGACACAACAAACAAGG - Intronic
961247833 3:125472015-125472037 AGGCTTACAGAGAAGAAACAGGG - Intronic
962514254 3:136135257-136135279 AGGCCTACACAGAACACATGTGG + Intronic
963080386 3:141387033-141387055 ATGCACACACAGCACAAGCACGG - Intronic
964259764 3:154822441-154822463 TGGCAGACACACAACAAAAAAGG - Intergenic
965495090 3:169388410-169388432 ATGCACAAACAGAACAAAGAAGG + Intronic
968590717 4:1458375-1458397 GGGCAAACACAGAACAGAGAGGG - Intergenic
969581815 4:8069938-8069960 AGGCACACAAACAACACACATGG - Intronic
969609873 4:8221010-8221032 AGGGATTCCCAGCACAAACAAGG + Intronic
970648323 4:18148458-18148480 AGCCATAAACAAAACAAACATGG - Intergenic
970866148 4:20761086-20761108 AGGCCTGAACAGAACAAAGACGG + Intronic
971620993 4:28853960-28853982 TGGCATAGACACAACAAAAAAGG - Intergenic
973557135 4:52094947-52094969 AGGCAGACACAGAAGACAGATGG - Exonic
973811526 4:54575078-54575100 AGGCATACCCAGGACAGCCAAGG - Intergenic
974032106 4:56785314-56785336 ATGCATACTAAGCACAAACACGG + Intergenic
976811617 4:89105963-89105985 AGACGTACACAGTATAAACAGGG - Intronic
977908762 4:102507316-102507338 AAGCATAAACAAAACAAACAAGG + Intronic
978140709 4:105314428-105314450 AGGCAGAGACACAACAAAAAAGG + Intergenic
978960943 4:114677700-114677722 AAGCATACACTCAACCAACAAGG - Exonic
980064954 4:128176828-128176850 ATGCAGACACAGCACAAAAAGGG + Intronic
980632255 4:135451067-135451089 AGGCAGAGACACAACAAAAAAGG + Intergenic
980782355 4:137508069-137508091 ACGCACACACAAAACAAGCATGG + Intergenic
981601075 4:146489361-146489383 AGGCTTACAGAGCGCAAACAAGG - Intronic
982208625 4:153017382-153017404 AGGAAAACAGAGAACAAAGAAGG - Intergenic
982559198 4:156908510-156908532 AGTAATACAAAGAACAAACTTGG + Intronic
982649280 4:158066299-158066321 AGCAATACAGAGAAAAAACAGGG - Intergenic
982731581 4:158961423-158961445 AGGCAGGCACAAAATAAACAAGG + Intronic
983468595 4:168127093-168127115 GGGCATACTGACAACAAACAGGG + Intronic
986222469 5:5781273-5781295 AGGCACACACGGAGCAAAGACGG + Intergenic
986913029 5:12580893-12580915 AGGCATATACATAAAAAATATGG - Intergenic
988070297 5:26279394-26279416 AGGGATACACAGAAGAAATATGG + Intergenic
988356941 5:30189551-30189573 AGGCATACACACAATAAATATGG + Intergenic
988995699 5:36713077-36713099 AAGCAGACACAGAAAAAGCATGG + Intergenic
989744850 5:44816552-44816574 AGGCATACACAGGAAATGCATGG - Intronic
989824037 5:45832317-45832339 AGGCATTCACAGCTCAATCAAGG - Intergenic
990066702 5:51725084-51725106 AAACATACACAAAACAAGCATGG + Intergenic
990602464 5:57373580-57373602 AGGAATATACATAACAAAGAAGG + Intergenic
991278710 5:64884080-64884102 ATGTATCCACAGGACAAACAAGG + Intronic
994051130 5:95364031-95364053 AGGTATACAGGCAACAAACATGG - Intergenic
994987841 5:106960925-106960947 AGCCATACAGAGAAAAAACTAGG - Intergenic
995098644 5:108271390-108271412 ATACACACACAGAACAAACCAGG + Intronic
995414933 5:111899265-111899287 AAGGATATACAGAACAATCAAGG + Intronic
996030472 5:118699111-118699133 ATGCATTCACTGAGCAAACAAGG + Intergenic
997361883 5:133300404-133300426 TGGCTCAGACAGAACAAACAGGG - Intronic
997437291 5:133884614-133884636 AGGCATGCACAGAACACAGGAGG + Intergenic
997527660 5:134563782-134563804 TGGCAGAGACAGAACCAACAGGG + Intronic
997751085 5:136346554-136346576 ACACATACACACAACACACACGG + Intronic
999809700 5:155115748-155115770 AAGCTTCCACAGAACAGACAGGG - Intergenic
1002627622 5:180542076-180542098 AGGCATACATAAAAGAAACAAGG - Intronic
1002878534 6:1232553-1232575 TGGTATACATAGAACAACCAGGG - Intergenic
1003015524 6:2464483-2464505 AGGACTAGACAGAACAGACATGG - Intergenic
1004089095 6:12481351-12481373 AGAAATAAACAGAATAAACAAGG + Intergenic
1004578454 6:16923216-16923238 ATGCAGCCAGAGAACAAACAAGG - Intergenic
1004840496 6:19578500-19578522 ATGCACACACAGACCACACATGG + Intergenic
1008370386 6:50724219-50724241 ATGCAACCGCAGAACAAACAGGG + Intronic
1008925990 6:56892710-56892732 AGGAATTCAGAGAACAAAGAGGG - Intronic
1009406434 6:63319180-63319202 TGGCATATAGAGAACAAACCTGG - Intronic
1010338758 6:74722830-74722852 AAGCATACACAGAAAAAGAAAGG - Intergenic
1014528476 6:122530473-122530495 AGGCATACAAAGAAAAAACATGG - Intronic
1014927966 6:127297498-127297520 AGGCACAAACAGAACAACCTGGG + Intronic
1016520020 6:144936536-144936558 AATCATAAAAAGAACAAACAAGG - Intergenic
1021138822 7:16998001-16998023 AGGAATACACCTAACAAAGAAGG - Intergenic
1022434369 7:30366231-30366253 ATGCATACAAAGGACACACAGGG + Exonic
1022635302 7:32127052-32127074 GGGCCTGCACAGAACAAAAAAGG + Intronic
1024168101 7:46754974-46754996 AGGACTACACAAAACACACAAGG + Intronic
1027974996 7:85141828-85141850 GGCCACACACAGAATAAACAAGG + Intronic
1028832525 7:95343110-95343132 AGGCATATAAATAACAAACTGGG - Intergenic
1028890306 7:95979775-95979797 TGGCATCCACAGAAGACACAAGG + Intronic
1029989955 7:104954138-104954160 AGGCAGGCAGAGAACAGACAAGG - Intergenic
1030547790 7:110919571-110919593 ATGCAAACAAGGAACAAACAAGG - Intronic
1030577056 7:111301443-111301465 AGTCTTACACAGAACAAATAAGG + Intronic
1031663025 7:124450831-124450853 AAGCACACACAGAAAATACATGG + Intergenic
1031943802 7:127817412-127817434 TGGCATAGACAGAAGAAACAGGG - Intronic
1032768713 7:135025754-135025776 AGGCAAACAGAAAACAAAAAAGG + Intronic
1032835277 7:135666726-135666748 AGAAATAAACATAACAAACAAGG - Intronic
1035381241 7:158442578-158442600 GGGCACACACATAACAAAAATGG - Intronic
1035829660 8:2680879-2680901 AGGCATCCAACGAGCAAACAGGG + Intergenic
1036524448 8:9521779-9521801 AGACATGCAAAGAAGAAACATGG + Intergenic
1038346743 8:26740017-26740039 AGGCATACACACACCAAACATGG + Intergenic
1039256480 8:35724440-35724462 TGCCATACACAGAACAGACTAGG + Intronic
1043472265 8:80574787-80574809 AGGTATAAAAAGAAAAAACAAGG + Intergenic
1043769421 8:84180074-84180096 AGGCAGAGACAGGACAAATAAGG + Intergenic
1045412770 8:101935505-101935527 AGGCAAATAAAGAACAAAAAGGG + Intronic
1045612526 8:103862684-103862706 AGGAATACACTTAACAAAGAAGG - Intronic
1046347059 8:112943882-112943904 AGGCATACAGATTAGAAACATGG - Intronic
1046757778 8:117989389-117989411 AGGCAGACAGACAAAAAACATGG - Intronic
1050324852 9:4489627-4489649 AGGCAAACACAGGAGAAACTAGG - Intergenic
1050603131 9:7272615-7272637 AGGCATAGACAGAACATTCTGGG + Intergenic
1052067518 9:24040573-24040595 TGGCATGCACAGAGCAAAGAGGG - Intergenic
1052200853 9:25778010-25778032 AGGCATTAACAGAAATAACATGG - Intergenic
1053144525 9:35703572-35703594 AGGCAACCACAGAACACATACGG - Exonic
1053727456 9:41018304-41018326 AGCCATATACAGAAAAAATAAGG - Intergenic
1054701057 9:68413803-68413825 AGCCATATACAGAAAAAATAAGG + Intronic
1055707409 9:79020837-79020859 AAGCAAAAACAGAACAAAAATGG + Intergenic
1056409761 9:86313343-86313365 GGGAATACACAGAAGAAGCAAGG + Intronic
1056616940 9:88176849-88176871 AGGCCTAAATAGAACAAAAAAGG - Intergenic
1056628369 9:88272884-88272906 AGGAATACAGTGAACCAACAGGG - Intergenic
1056770902 9:89477490-89477512 AGGGACACACAGCACACACAAGG + Intronic
1056950799 9:91039510-91039532 ATGCATTCACAGCACACACATGG + Intergenic
1057015266 9:91645444-91645466 AGGCAAGGCCAGAACAAACATGG - Intronic
1057092479 9:92271583-92271605 AAGCATCCACAGGGCAAACAGGG + Exonic
1059333740 9:113555139-113555161 AGGAATAGACAGATCAAAGAGGG - Intronic
1061946504 9:133911306-133911328 AGGCATCCGCAGCACAGACACGG - Intronic
1062570788 9:137184249-137184271 ATGCAGACACAGAGCAGACACGG + Intronic
1062570816 9:137184421-137184443 ACGCAGACACAGAGCAGACACGG + Intronic
1062570822 9:137184465-137184487 ACGCAGACACAGAGCAGACACGG + Intronic
1062570859 9:137184677-137184699 ACGCAGACACAGAGCAGACACGG + Intronic
1062570869 9:137184742-137184764 ACGCAGACACAGAGCAGACACGG + Intronic
1062570878 9:137184786-137184808 ACGCAGACACAGAGCAGACACGG + Intronic
1186308246 X:8288668-8288690 AGACAAAGACATAACAAACAAGG + Intergenic
1186952719 X:14645170-14645192 AACCATGCACAGAGCAAACATGG - Intronic
1187558695 X:20378570-20378592 AGGGTTACACAGTACAAACATGG - Intergenic
1187573056 X:20524907-20524929 AGGCATACACAGCACATACTTGG - Intergenic
1187647604 X:21365536-21365558 AGCCATACACAGCAAAGACATGG - Intergenic
1190998576 X:55636456-55636478 AGGCATAAAAAAAACACACAAGG - Intergenic
1191046067 X:56138346-56138368 TGGCACAGACAGAACAAAAAAGG + Intergenic
1191952516 X:66608233-66608255 TGGGATTCACAGAAAAAACAGGG + Intronic
1192786351 X:74339861-74339883 AGGCATACAAAGAAACAAGAAGG - Intergenic
1193466965 X:81860950-81860972 AGACATACATAGAATAAAAAGGG + Intergenic
1193748520 X:85313636-85313658 TGGCAGAGACAGAACAAAAAAGG - Intronic
1194003972 X:88467579-88467601 AGGCACATACAGAAGATACATGG - Intergenic
1194409540 X:93540980-93541002 AGGCATAAAAAGAAAAAATAAGG + Intergenic
1194692391 X:97003579-97003601 AGACATACAAATAGCAAACAGGG - Intronic
1194723363 X:97366053-97366075 AGGAATTCACAGCACAAAGAAGG - Intronic
1195856279 X:109336004-109336026 AGACTTAGACAGAAAAAACAAGG - Intergenic
1199348463 X:146770727-146770749 AGGCATACAAAGCCCAAAGATGG + Intergenic
1199740868 X:150735030-150735052 AGGCACACACAGAAGGAAGATGG + Intronic
1202094042 Y:21226335-21226357 AGGCATACAGAGAAACAAAATGG - Intergenic
1202372944 Y:24210533-24210555 GGGTATACACATAACAACCAGGG + Intergenic
1202497838 Y:25459587-25459609 GGGTATACACATAACAACCAGGG - Intergenic