ID: 1132433722

View in Genome Browser
Species Human (GRCh38)
Location 15:101780063-101780085
Sequence GTGTTCCAGCAGGAGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132433722_1132433727 14 Left 1132433722 15:101780063-101780085 CCTCTCTGCTCCTGCTGGAACAC No data
Right 1132433727 15:101780100-101780122 TGCCAATATTCTTTTAACTGTGG No data
1132433722_1132433728 15 Left 1132433722 15:101780063-101780085 CCTCTCTGCTCCTGCTGGAACAC No data
Right 1132433728 15:101780101-101780123 GCCAATATTCTTTTAACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132433722 Original CRISPR GTGTTCCAGCAGGAGCAGAG AGG (reversed) Intergenic
No off target data available for this crispr