ID: 1132433796

View in Genome Browser
Species Human (GRCh38)
Location 15:101780966-101780988
Sequence TTCGGAGACCACTGAATGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132433791_1132433796 13 Left 1132433791 15:101780930-101780952 CCAAGATCTATTCCACAGAAGAT 0: 35
1: 14
2: 7
3: 16
4: 172
Right 1132433796 15:101780966-101780988 TTCGGAGACCACTGAATGAAGGG No data
1132433792_1132433796 1 Left 1132433792 15:101780942-101780964 CCACAGAAGATGAGCCAATCTCA No data
Right 1132433796 15:101780966-101780988 TTCGGAGACCACTGAATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132433796 Original CRISPR TTCGGAGACCACTGAATGAA GGG Intergenic
No off target data available for this crispr