ID: 1132434078

View in Genome Browser
Species Human (GRCh38)
Location 15:101782281-101782303
Sequence CTCCACTCTCTTAGAGTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132434078_1132434089 4 Left 1132434078 15:101782281-101782303 CCGCCCACTCTAAGAGAGTGGAG No data
Right 1132434089 15:101782308-101782330 CACCCACTCTGGGACAGGGGAGG No data
1132434078_1132434084 -6 Left 1132434078 15:101782281-101782303 CCGCCCACTCTAAGAGAGTGGAG No data
Right 1132434084 15:101782298-101782320 GTGGAGGGACCACCCACTCTGGG No data
1132434078_1132434094 10 Left 1132434078 15:101782281-101782303 CCGCCCACTCTAAGAGAGTGGAG No data
Right 1132434094 15:101782314-101782336 CTCTGGGACAGGGGAGGGGCTGG No data
1132434078_1132434083 -7 Left 1132434078 15:101782281-101782303 CCGCCCACTCTAAGAGAGTGGAG No data
Right 1132434083 15:101782297-101782319 AGTGGAGGGACCACCCACTCTGG No data
1132434078_1132434085 -1 Left 1132434078 15:101782281-101782303 CCGCCCACTCTAAGAGAGTGGAG No data
Right 1132434085 15:101782303-101782325 GGGACCACCCACTCTGGGACAGG No data
1132434078_1132434092 6 Left 1132434078 15:101782281-101782303 CCGCCCACTCTAAGAGAGTGGAG No data
Right 1132434092 15:101782310-101782332 CCCACTCTGGGACAGGGGAGGGG No data
1132434078_1132434086 0 Left 1132434078 15:101782281-101782303 CCGCCCACTCTAAGAGAGTGGAG No data
Right 1132434086 15:101782304-101782326 GGACCACCCACTCTGGGACAGGG No data
1132434078_1132434090 5 Left 1132434078 15:101782281-101782303 CCGCCCACTCTAAGAGAGTGGAG No data
Right 1132434090 15:101782309-101782331 ACCCACTCTGGGACAGGGGAGGG No data
1132434078_1132434087 1 Left 1132434078 15:101782281-101782303 CCGCCCACTCTAAGAGAGTGGAG No data
Right 1132434087 15:101782305-101782327 GACCACCCACTCTGGGACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132434078 Original CRISPR CTCCACTCTCTTAGAGTGGG CGG (reversed) Intergenic
No off target data available for this crispr