ID: 1132444979

View in Genome Browser
Species Human (GRCh38)
Location 15:101907683-101907705
Sequence ATACAGAAAAGGAAAGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132444979_1132444983 10 Left 1132444979 15:101907683-101907705 CCCTCTGCTTTCCTTTTCTGTAT No data
Right 1132444983 15:101907716-101907738 TATTAACTTAGTGGTTACCATGG No data
1132444979_1132444984 11 Left 1132444979 15:101907683-101907705 CCCTCTGCTTTCCTTTTCTGTAT No data
Right 1132444984 15:101907717-101907739 ATTAACTTAGTGGTTACCATGGG No data
1132444979_1132444985 12 Left 1132444979 15:101907683-101907705 CCCTCTGCTTTCCTTTTCTGTAT No data
Right 1132444985 15:101907718-101907740 TTAACTTAGTGGTTACCATGGGG No data
1132444979_1132444982 1 Left 1132444979 15:101907683-101907705 CCCTCTGCTTTCCTTTTCTGTAT No data
Right 1132444982 15:101907707-101907729 TTCAAAAGATATTAACTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132444979 Original CRISPR ATACAGAAAAGGAAAGCAGA GGG (reversed) Intergenic
No off target data available for this crispr