ID: 1132448474

View in Genome Browser
Species Human (GRCh38)
Location 15:101951337-101951359
Sequence TATTGTATAAGATCACTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132448474_1132448478 30 Left 1132448474 15:101951337-101951359 CCAGCCAGTGATCTTATACAATA No data
Right 1132448478 15:101951390-101951412 CTCCTTCATAAGCAAGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132448474 Original CRISPR TATTGTATAAGATCACTGGC TGG (reversed) Intergenic
No off target data available for this crispr