ID: 1132448478

View in Genome Browser
Species Human (GRCh38)
Location 15:101951390-101951412
Sequence CTCCTTCATAAGCAAGCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132448475_1132448478 26 Left 1132448475 15:101951341-101951363 CCAGTGATCTTATACAATATGAT No data
Right 1132448478 15:101951390-101951412 CTCCTTCATAAGCAAGCCACAGG No data
1132448474_1132448478 30 Left 1132448474 15:101951337-101951359 CCAGCCAGTGATCTTATACAATA No data
Right 1132448478 15:101951390-101951412 CTCCTTCATAAGCAAGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132448478 Original CRISPR CTCCTTCATAAGCAAGCCAC AGG Intergenic
No off target data available for this crispr