ID: 1132448690

View in Genome Browser
Species Human (GRCh38)
Location 15:101952983-101953005
Sequence TAGCCAGGAGTCTCATCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132448690_1132448696 13 Left 1132448690 15:101952983-101953005 CCAGGGGATGAGACTCCTGGCTA No data
Right 1132448696 15:101953019-101953041 CCTCCCCTTCAACTTTACTCAGG No data
1132448690_1132448700 19 Left 1132448690 15:101952983-101953005 CCAGGGGATGAGACTCCTGGCTA No data
Right 1132448700 15:101953025-101953047 CTTCAACTTTACTCAGGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132448690 Original CRISPR TAGCCAGGAGTCTCATCCCC TGG (reversed) Intergenic
No off target data available for this crispr