ID: 1132449510

View in Genome Browser
Species Human (GRCh38)
Location 15:101958822-101958844
Sequence AAGGCTGCAGGGTTGGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132449510_1132449518 6 Left 1132449510 15:101958822-101958844 CCTGGGACCAACCCTGCAGCCTT No data
Right 1132449518 15:101958851-101958873 CCAGGCCCGCTCAGCCCAGCTGG No data
1132449510_1132449521 16 Left 1132449510 15:101958822-101958844 CCTGGGACCAACCCTGCAGCCTT No data
Right 1132449521 15:101958861-101958883 TCAGCCCAGCTGGCCAGCAAAGG No data
1132449510_1132449523 20 Left 1132449510 15:101958822-101958844 CCTGGGACCAACCCTGCAGCCTT No data
Right 1132449523 15:101958865-101958887 CCCAGCTGGCCAGCAAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132449510 Original CRISPR AAGGCTGCAGGGTTGGTCCC AGG (reversed) Intergenic
No off target data available for this crispr