ID: 1132449523

View in Genome Browser
Species Human (GRCh38)
Location 15:101958865-101958887
Sequence CCCAGCTGGCCAGCAAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132449514_1132449523 8 Left 1132449514 15:101958834-101958856 CCTGCAGCCTTAATTTCCCAGGC No data
Right 1132449523 15:101958865-101958887 CCCAGCTGGCCAGCAAAGGCAGG No data
1132449511_1132449523 13 Left 1132449511 15:101958829-101958851 CCAACCCTGCAGCCTTAATTTCC No data
Right 1132449523 15:101958865-101958887 CCCAGCTGGCCAGCAAAGGCAGG No data
1132449510_1132449523 20 Left 1132449510 15:101958822-101958844 CCTGGGACCAACCCTGCAGCCTT No data
Right 1132449523 15:101958865-101958887 CCCAGCTGGCCAGCAAAGGCAGG No data
1132449516_1132449523 -8 Left 1132449516 15:101958850-101958872 CCCAGGCCCGCTCAGCCCAGCTG No data
Right 1132449523 15:101958865-101958887 CCCAGCTGGCCAGCAAAGGCAGG No data
1132449517_1132449523 -9 Left 1132449517 15:101958851-101958873 CCAGGCCCGCTCAGCCCAGCTGG No data
Right 1132449523 15:101958865-101958887 CCCAGCTGGCCAGCAAAGGCAGG No data
1132449512_1132449523 9 Left 1132449512 15:101958833-101958855 CCCTGCAGCCTTAATTTCCCAGG No data
Right 1132449523 15:101958865-101958887 CCCAGCTGGCCAGCAAAGGCAGG No data
1132449515_1132449523 1 Left 1132449515 15:101958841-101958863 CCTTAATTTCCCAGGCCCGCTCA No data
Right 1132449523 15:101958865-101958887 CCCAGCTGGCCAGCAAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132449523 Original CRISPR CCCAGCTGGCCAGCAAAGGC AGG Intergenic
No off target data available for this crispr