ID: 1132449565

View in Genome Browser
Species Human (GRCh38)
Location 15:101959153-101959175
Sequence GTGTATATTCACAGGCATCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132449563_1132449565 4 Left 1132449563 15:101959126-101959148 CCAGGCTTGGTATATGATGTGGT No data
Right 1132449565 15:101959153-101959175 GTGTATATTCACAGGCATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132449565 Original CRISPR GTGTATATTCACAGGCATCG TGG Intergenic
No off target data available for this crispr