ID: 1132449892

View in Genome Browser
Species Human (GRCh38)
Location 15:101961460-101961482
Sequence GACCCGGAGCGCTGTCCTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132449892_1132449905 16 Left 1132449892 15:101961460-101961482 CCACGAGGACAGCGCTCCGGGTC No data
Right 1132449905 15:101961499-101961521 CGCGCTCGGGGAGGGCGCAGCGG No data
1132449892_1132449898 2 Left 1132449892 15:101961460-101961482 CCACGAGGACAGCGCTCCGGGTC No data
Right 1132449898 15:101961485-101961507 CGGGGTCCTGGAGCCGCGCTCGG No data
1132449892_1132449909 30 Left 1132449892 15:101961460-101961482 CCACGAGGACAGCGCTCCGGGTC No data
Right 1132449909 15:101961513-101961535 GCGCAGCGGAGGGCGAGCGGCGG No data
1132449892_1132449906 19 Left 1132449892 15:101961460-101961482 CCACGAGGACAGCGCTCCGGGTC No data
Right 1132449906 15:101961502-101961524 GCTCGGGGAGGGCGCAGCGGAGG No data
1132449892_1132449903 8 Left 1132449892 15:101961460-101961482 CCACGAGGACAGCGCTCCGGGTC No data
Right 1132449903 15:101961491-101961513 CCTGGAGCCGCGCTCGGGGAGGG No data
1132449892_1132449908 27 Left 1132449892 15:101961460-101961482 CCACGAGGACAGCGCTCCGGGTC No data
Right 1132449908 15:101961510-101961532 AGGGCGCAGCGGAGGGCGAGCGG No data
1132449892_1132449899 3 Left 1132449892 15:101961460-101961482 CCACGAGGACAGCGCTCCGGGTC No data
Right 1132449899 15:101961486-101961508 GGGGTCCTGGAGCCGCGCTCGGG No data
1132449892_1132449901 7 Left 1132449892 15:101961460-101961482 CCACGAGGACAGCGCTCCGGGTC No data
Right 1132449901 15:101961490-101961512 TCCTGGAGCCGCGCTCGGGGAGG No data
1132449892_1132449907 20 Left 1132449892 15:101961460-101961482 CCACGAGGACAGCGCTCCGGGTC No data
Right 1132449907 15:101961503-101961525 CTCGGGGAGGGCGCAGCGGAGGG No data
1132449892_1132449900 4 Left 1132449892 15:101961460-101961482 CCACGAGGACAGCGCTCCGGGTC No data
Right 1132449900 15:101961487-101961509 GGGTCCTGGAGCCGCGCTCGGGG No data
1132449892_1132449896 -10 Left 1132449892 15:101961460-101961482 CCACGAGGACAGCGCTCCGGGTC No data
Right 1132449896 15:101961473-101961495 GCTCCGGGTCGACGGGGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132449892 Original CRISPR GACCCGGAGCGCTGTCCTCG TGG (reversed) Intergenic
No off target data available for this crispr