ID: 1132449897

View in Genome Browser
Species Human (GRCh38)
Location 15:101961476-101961498
Sequence GCTCCAGGACCCCGTCGACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132449897_1132449910 21 Left 1132449897 15:101961476-101961498 CCGGGTCGACGGGGTCCTGGAGC No data
Right 1132449910 15:101961520-101961542 GGAGGGCGAGCGGCGGCGTTAGG No data
1132449897_1132449903 -8 Left 1132449897 15:101961476-101961498 CCGGGTCGACGGGGTCCTGGAGC No data
Right 1132449903 15:101961491-101961513 CCTGGAGCCGCGCTCGGGGAGGG No data
1132449897_1132449911 27 Left 1132449897 15:101961476-101961498 CCGGGTCGACGGGGTCCTGGAGC No data
Right 1132449911 15:101961526-101961548 CGAGCGGCGGCGTTAGGACCCGG No data
1132449897_1132449909 14 Left 1132449897 15:101961476-101961498 CCGGGTCGACGGGGTCCTGGAGC No data
Right 1132449909 15:101961513-101961535 GCGCAGCGGAGGGCGAGCGGCGG No data
1132449897_1132449908 11 Left 1132449897 15:101961476-101961498 CCGGGTCGACGGGGTCCTGGAGC No data
Right 1132449908 15:101961510-101961532 AGGGCGCAGCGGAGGGCGAGCGG No data
1132449897_1132449907 4 Left 1132449897 15:101961476-101961498 CCGGGTCGACGGGGTCCTGGAGC No data
Right 1132449907 15:101961503-101961525 CTCGGGGAGGGCGCAGCGGAGGG No data
1132449897_1132449901 -9 Left 1132449897 15:101961476-101961498 CCGGGTCGACGGGGTCCTGGAGC No data
Right 1132449901 15:101961490-101961512 TCCTGGAGCCGCGCTCGGGGAGG No data
1132449897_1132449906 3 Left 1132449897 15:101961476-101961498 CCGGGTCGACGGGGTCCTGGAGC No data
Right 1132449906 15:101961502-101961524 GCTCGGGGAGGGCGCAGCGGAGG No data
1132449897_1132449912 30 Left 1132449897 15:101961476-101961498 CCGGGTCGACGGGGTCCTGGAGC No data
Right 1132449912 15:101961529-101961551 GCGGCGGCGTTAGGACCCGGAGG No data
1132449897_1132449905 0 Left 1132449897 15:101961476-101961498 CCGGGTCGACGGGGTCCTGGAGC No data
Right 1132449905 15:101961499-101961521 CGCGCTCGGGGAGGGCGCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132449897 Original CRISPR GCTCCAGGACCCCGTCGACC CGG (reversed) Intergenic
No off target data available for this crispr