ID: 1132449901

View in Genome Browser
Species Human (GRCh38)
Location 15:101961490-101961512
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132449889_1132449901 19 Left 1132449889 15:101961448-101961470 CCGCGACTCGGTCCACGAGGACA No data
Right 1132449901 15:101961490-101961512 TCCTGGAGCCGCGCTCGGGGAGG No data
1132449886_1132449901 25 Left 1132449886 15:101961442-101961464 CCAGGCCCGCGACTCGGTCCACG No data
Right 1132449901 15:101961490-101961512 TCCTGGAGCCGCGCTCGGGGAGG No data
1132449885_1132449901 26 Left 1132449885 15:101961441-101961463 CCCAGGCCCGCGACTCGGTCCAC No data
Right 1132449901 15:101961490-101961512 TCCTGGAGCCGCGCTCGGGGAGG No data
1132449892_1132449901 7 Left 1132449892 15:101961460-101961482 CCACGAGGACAGCGCTCCGGGTC No data
Right 1132449901 15:101961490-101961512 TCCTGGAGCCGCGCTCGGGGAGG No data
1132449897_1132449901 -9 Left 1132449897 15:101961476-101961498 CCGGGTCGACGGGGTCCTGGAGC No data
Right 1132449901 15:101961490-101961512 TCCTGGAGCCGCGCTCGGGGAGG No data
1132449888_1132449901 20 Left 1132449888 15:101961447-101961469 CCCGCGACTCGGTCCACGAGGAC No data
Right 1132449901 15:101961490-101961512 TCCTGGAGCCGCGCTCGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132449901 Original CRISPR TCCTGGAGCCGCGCTCGGGG AGG Intergenic
No off target data available for this crispr