ID: 1132449905

View in Genome Browser
Species Human (GRCh38)
Location 15:101961499-101961521
Sequence CGCGCTCGGGGAGGGCGCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132449889_1132449905 28 Left 1132449889 15:101961448-101961470 CCGCGACTCGGTCCACGAGGACA No data
Right 1132449905 15:101961499-101961521 CGCGCTCGGGGAGGGCGCAGCGG No data
1132449897_1132449905 0 Left 1132449897 15:101961476-101961498 CCGGGTCGACGGGGTCCTGGAGC No data
Right 1132449905 15:101961499-101961521 CGCGCTCGGGGAGGGCGCAGCGG No data
1132449888_1132449905 29 Left 1132449888 15:101961447-101961469 CCCGCGACTCGGTCCACGAGGAC No data
Right 1132449905 15:101961499-101961521 CGCGCTCGGGGAGGGCGCAGCGG No data
1132449892_1132449905 16 Left 1132449892 15:101961460-101961482 CCACGAGGACAGCGCTCCGGGTC No data
Right 1132449905 15:101961499-101961521 CGCGCTCGGGGAGGGCGCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132449905 Original CRISPR CGCGCTCGGGGAGGGCGCAG CGG Intergenic
No off target data available for this crispr