ID: 1132449906

View in Genome Browser
Species Human (GRCh38)
Location 15:101961502-101961524
Sequence GCTCGGGGAGGGCGCAGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132449897_1132449906 3 Left 1132449897 15:101961476-101961498 CCGGGTCGACGGGGTCCTGGAGC No data
Right 1132449906 15:101961502-101961524 GCTCGGGGAGGGCGCAGCGGAGG No data
1132449892_1132449906 19 Left 1132449892 15:101961460-101961482 CCACGAGGACAGCGCTCCGGGTC No data
Right 1132449906 15:101961502-101961524 GCTCGGGGAGGGCGCAGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132449906 Original CRISPR GCTCGGGGAGGGCGCAGCGG AGG Intergenic
No off target data available for this crispr